GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

DMBX1
diencephalon/mesencephalon homeobox 1

Gene
Official SymbolDMBX1
Official Full Namediencephalon/mesencephalon homeobox 1
CGNC ID7944
also known asdiencephalon/mesencephalon homeobox protein 1|paired-type homeobox Atx
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_422451
PolypeptideXP_422451
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.95
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human127343ENSG00000197587MIM:607410
Mouse140477ENSMUSG00000028707All phenotypic alleles (6):Targeted, knock-out(1) Targeted, other(5) MGI:2153518
Xenopus100493907486745
Zebrafish142987, 550288ENSDARG00000009922, ENSDARG00000002510ZDB-GENE-020117-1, ZDB-GENE-050417-97ZFIN:ZDB-GENE-020117-1, ZFIN:ZDB-GENE-050417-97
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395271
Ensembl GeneENSGALG00000010436
KEGGgga:395271

Entry 1

GEISHA IdDMBX1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAGCACTATGGGGTGAACGGATAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGAAGGAGGAGTAATGGACCAAGTTGcDNA Template Length839
Forward cDNA Template Probeshow
GGTAGCTGCCAGGTGCTGGCGGAAATTGCTCCTGCAGGCGGAAGAGGCTCAGGGGTGAGGAGGAAGTAGGAGTGAGTTT
GAGCCAGGCCACTGCTAGATGAAGGAGTCACGGTCGCGCTGATGGGAGACTCTGATTTTGGGCTCGCTCTCTTGCAGTT
CAAAGCCTTGCCGTCCACACCAGGACTCTTGTCCACTTTAGCCTCATCCAAGGTGCTCTTAAACTCCTCCTCTCTGTCA
GTCTGGTCCTCAGGCGCTGATTCACTGGCTGACTGCTCCGACAGGGTTAGGTTGAGGTCTGTGCTCACCTCACTTGGGA
TGCTCTGAGTCTTCTCAGTGTCAGGTATTGTGGACTGGGTCTCCAGCACAGGTGGTTCCGTCTTCCCCTCACTGTGGCT
GCTTTCACAGTCCTTCTGCTTCTGCAGCTGCTCCTTCTGGAGGCTACGCTGCTTCTTCCGGAATTTGGCCCTTCGGTTC
TTGAACCAAACCTGGACTCTGGCTTCAGGCAGATTTGTGCACATAGCCAGCCGCTCTCTCATCACTACATCTGGATAGT
GTGTCTTCTGGAAGGTCTTCTCCAGTGCCTCCAGCTGTTGGGCAGTGAAGGCCGTGCGACTTCGCCTTTGTTTGCGGTG
CTGGGATCCATAACGTGCCTCCAAAATGATGTCATCCAATCTCTCNGCCANGNTGATGNCGTGCACTGAGNGCCNGTAC
TCTGNCGCNTGCTNTGCTTGCTNGNCTGCCTGCTGNTGCANGTTGTACATGGCNCTCATTNANTTCATGNCATGCAAGN
ANTATCCATTCACCCNNTANTGC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Ectoderm
Headfold
Lateral Plate Mesoderm
precursor heart field
7-12
stage 7
stage 7
stage 8
stage 8
stage 9
stage 10
stage 11
stage 12
Ectoderm
Headfold
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Paraxial Mesoderm
Somites
Dorsal view.
Ventral view.
precursor heart field
13-18
stage 18
Forebrain
Hindbrain
Midbrain
Nasal Placode/Nerve
Oral Pharynx
 
19-24
stage 19
stage 21
stage 21
stage 21
stage 23
stage 23
stage 23
stage 23
stage 24
Diencephalon
Hindbrain
Midbrain
Nasal Placode/Nerve
Oral Pharynx
Pituitary (Rudiment)
Rathke's pouch

Entry 2

GEISHA IdATX.Ohuchi.2010Data SourcePublication
Complete cDNA Template Probeshow
GGTGTGAACGGATACTCCCTGCATGCCATGAACTCACTGAGCGCCATGTACAACCTGCACCAGCAGGCAGCCCAGCAAG
CACAGCACGCGCCCGACTACCGGCCCTCAGTGCACGCCCTCACCCTGGCGGAGAGACTGGCTGGCTGTACATTTCAAGA
CATCATTTTGGAGGCACGTTATGGATCCCAGCACCGCAAACAAAGGCGAAGTCGCACGGCCTTCACTGCCCAACAGCTG
GAGGCACTGGAGAAGACCTTCCAGAAGACACACTATCCAGATGTAGTGATGAGAGAGCGGCTGGCTATGTGCACAAATC
TGCCTGAAGCCAGAGTCCAGGTTTGGTTCAAGAACCGAAGGGCCAAATTCCGGAAGAAGCAGCGTAGCCTCCAGAAGGA
GCAGCTGCAGAAGCAGAAGGACTGTGAAAGCAGCCACAGTGAGGGGAAGACGGAACCACCTGTGCTGGAGACCCAGTCC
ACAATACCTGACACTGAGAAGACTCAGAGCATCCCAAGTGAGGTGAGCACAGACCTCAACCTAACCCTGTCGGAGCAGT
CAGCCAGTGAATCAGCGCCTGAGGACCAGACTGACAGAGAGGAGGAGTTTAAGAGCACCTTGGATGAGGCTAAAGTGGA
CAAGAGTCCTGGTGTAAGNGACGGCAAGGCTTTGAACTGCAAGAGAGCGAGCCCAAAATCAGAGTCTCCCATCAGCGCG
ACCGTGACTCCTTCATCTAGCAGTGGCCTGGCTCAAACTCACTCCTACTCCTCCTCACCCCTGAGCCTCTTCCGCCTGC
AGGAGCAATTCCGCCAGCACATGGCAGCTACCAACAACTTGGTCCATTACTCCTCCTTCGAAATGGGGACACCGTCTGC
CATGCCCTACTTGGGCATGAATGTTCAACATTGGCGCCT
CitationOhuchi H, Fukui H, Matsuyo A, Tomonari S, Tanaka M, Arai H, Noji S, Aoki J. Autotaxin controls caudal diencephalon-mesencephalon development in the chick. Dev Dyn. 2010 Oct;239(10):2647-58.
CopyrightCopyright © 1999–2011 John Wiley & Sons, Inc. All Rights Reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #AF461038)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
Midbrain
 
19-21
stage 21
stage 21
Diencephalon
 

Entry 3

GEISHA IdDMBX1.Ferran.2007Data SourcePublication
Complete cDNA Template Probeshow
TGTGAAAGCAGCCACAGTGAGGGGAAGACGGAACCACCTGTGCTGGAGACCCAGTCCACAATACCTGACACTGAGAAGA
CTCAGAGCATCCCAAGTGAGGTGAGCACAGACCTCAACCTAACCCTGTCGGAGCAGTCAGCCAGTGAATCAGCGCCTGA
GGACCAGACTGACAGAGAGGAGGAGTTTAAGAGCACCTTGGATGAGGCTAAAGTGGACAAGAGTCCTGGTGTAAGNGAC
GGCAAGGCTTTGAACTGCAAGAGAGCGAGCCCAAAATCAGAGTCTCCCATCAGCGCGACCGTGACTCCTTCATCTAGCA
GTGGCCTGGCTCAAACTCACTCCTACTCCTCCTCACCCCTGAGCCTCTTCCGCCTGCAGGAGCAATTCCGCCAGCACAT
GGCAGCTACCAACAA
CitationFerran JL, Sánchez-Arrones L, Sandoval JE, Puelles L. A model of early molecular regionalization in the chicken embryonic pretectum. J Comp Neurol. 2007 Dec 1;505(4):379-403.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
CommentsThe sequence below was obtained from NCBI (acc #: AF461038 - Showing 410 bp region from base 418 to 827) using the information provided in the publication Primers are given in the methods.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
stage 23
stage 23
stage 23
Diencephalon
Mesencephalon
Neural Plate/Tube
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.95

Mouse

EmageMGI:2153518
EurexpressMGI:2153518
MGI GXDMGI:2153518

Frog

Xenbase486745

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020117-1, ZDB-GENE-050417-97
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona