Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
EEF1A1 Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol EEF1A1 Official Full Name eukaryotic translation elongation factor 1 alpha 1 CGNC ID 48980 also known as EEF1A, EF1A, elongation factor 1-alpha 1|EF-1-alpha-1|EF-Tu|elongation factor 1 alpha|elongation factor Tu gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Entrez Gene Ensembl Gene Genetic Phenotypes MOD Fruit Fly 36271 FBgn0000556 Human 1915 ENSG00000156508 MIM:130590 Mouse Xenopus 549446 , 386604 480093 Zebrafish 664756 , 30516 , 100004503 , 336334 ENSDARG00000020850 , ENSDARG00000069951 , ENSDARG00000039502 ZDB-GENE-050706-188 , ZDB-GENE-990415-52 , ZDB-GENE-050417-327 , ZDB-GENE-030131-8278 ZFIN:ZDB-GENE-050706-188 , ZFIN:ZDB-GENE-990415-52 , ZFIN:ZDB-GENE-050417-327 , ZFIN:ZDB-GENE-030131-8278
Gene Ontology Links to other databases
GEISHA Id EF1ALPHA.Chambers.2006 Data Source Publication Complete cDNA Template Probe show ACTTGTGGTCAACTCAGAAAGGAGAAGCTCCTGCTGAGGGAGTGCTGGGGATGGTGCTGTGAGGAGAGGCACTGCTGCT
Citation Chambers, D, Mason, I, A high throughput messenger RNA differential display screen identifies discrete domains of gene expression and novel patterning processes along the developing neural tube. BMC Dev Biol. 2006; 6: 9. Published online 2006 February 24. Copyright Copyright © 2006 Chambers and Mason; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204157.2). There is also an alpha 2 gene (NM_001032398.2)
Data from NCBI Unigene EST ProfileGga.34328
Mouse Frog Fruit Fly Zebra Finch Zebrafish
