GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ETV5
ETS variant 5

Gene
Official SymbolETV5
Official Full NameETS variant 5
CGNC ID4300
also known asERM, ETS translocation variant 5|ets domain protein|ets variant gene 5 (ets-related molecule), Erm, Ets domain protein, ETV5
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_422651
PolypeptideXP_422651
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1104
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2119ENSG00000244405MIM:601600
Mouse104156ENSMUSG00000013089All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:1096867
Xenopus
Zebrafish100332865, 337626, 30452ENSDARG00000069763, ENSDARG00000044511ZDB-GENE-030131-9572, ZDB-GENE-991228-4ZFIN:ZDB-GENE-030131-9572, ZFIN:ZDB-GENE-991228-4
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395749
Ensembl Gene
KEGGgga:395749

Entry 1

GEISHA IdErm.Lunn.2007Data SourcePublication
Complete cDNA Template Probeshow
CCGGCCCCAGCCTGCCCGGCCCCCCCGGCACGGCTTCCAGTCCCCCATGGGCATCAAGCAGGAGCCCCGGGACTACTGC
ATCGACTCAGAAGTGCCTAACTGCCAGTCCTCATATGTGAGAGGGGGCCTCTTCCCCAGCAGCCACGATGGATTCTCGT
ATGAAAAAGACACACGATTGTATTTTGATGACACGTGCGTGGTACCAGAGAGACTGGAGGGTAAGGTGAAGCAGGAGCC
CACCCTGTACCGTGAGGGCCCTCCCTACCAGCGGCGCGGGTCGCTGCAGCTCTGGCAGTTCCTCGTCACGCTCCTGGAC
GACCCCGCCAACGCTCACTTCATCGCCTGGACCGGCCGCGGCATGGAGTTCAAGCTGATCGAGCCCGAGGAGGTAGCAC
GGCGCTGGGGCATCCAGAAGAACCGGCCGGCCATGAACTACGACAAGCTGAGCCGCTCCCTGCGCTACTACTACGAGAA
GGGCATCATGCAGAAGGTGGCCGGCGAGCGGTACGTCTACAAGTTTGTGTGTGACCCCGACGCCCTCTTCTCCATGGCG
TACCCCGACAATCAGCGGCCCTTCCTGAAAGCGGAGCCCGACTGCCACGTGAGCGAGGAGGACACCCTGCCGCTGACGC
ACTTTGAGGACAGCCCTGCCTACCTGCTGGAGGTGGAGCACTGCGGCAGCCTGCCCTACGCGGAGGGCTTTGCCTACTG
ATGGCCGGCTGGCGGAGCGACCAGCGCTAGCACGCACGTCTGCTGGGGGCCAACAAGGGCAAAGGTTTTGTAAAGAGTA
TTTTTTTGCCATTTCTTTTAACAGTG
CitationLunn JS, Fishwick KJ, Halley PA, Storey KG. A spatial and temporal map of FGF/Erk1/2 activity and response repertoires in the early chick embryo. Dev Biol. 2007 Feb 15;302(2):536-52. Epub 2006 Oct 14.
CopyrightCopyright © 2006 Elsevier Inc. All rights reserved.
CommentsInsufficient information in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc #AF075706).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Epiblast
Neural Plate/Tube
Primitive Streak
 
4-6
stage 5
stage 6
Epiblast
Neural Plate/Tube
Primitive Streak
Unlabeled
 
7-10
stage 7
stage 8
stage 10
stage 10
Ectoderm
Epiblast
Intermediate Mesoderm
Myocardium
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
Expressed in ectoderm at level of future otic vesicle
Undetectable in neural plate adjacent to somites

Entry 2

GEISHA IdErm.Brent.2004Data SourcePublication
Complete cDNA Template Probeshow
CCGGCCCCAGCCTGCCCGGCCCCCCCGGGCACGGCTTCCAGTCCCCCATGGGCATCAAGCAGGAGCCCCGGGACTACTG
CATCGACTCAGAAGTGCCTAACTGCCAGTCCTCATATGTGAGAGGGGGCCTCTTCCCCAGCAGCCACGATGGATTCTCG
TATGAAAAAGACACACGATTGTATTTTGATGACACGTGCGTGGTACCAGAGAGACTGGAGGGTAAGGTGAAGCAGGAGC
CCACCCTGTACCGCGAGGGCCCTCCCTACCAGCGGCGTGGGTCGCTGCAGCTCTGGCAGTTCCTCGTCACGCTCCTGGA
CGACCCCGCCAACGCTCACTTCATCGCCTGGACCGGCCGCGGCATGGAGTTCAAGCTGATCGAGCCCGAGGAGGTAGCA
CGGCGCTGGGGCATCCAGAAGAACCGGCCGGCCATGAACTACGACAAGCTGAGCCGCTCCCTGCGCTACTACTACGAGA
AGGGCATCATGCAGAAGGTGGCCGGCGAGCGGTACGTCTACAAGTTCGTGTGTGACCCCGATGCCCTCTTCTCCATGGC
GTACCCCGACAATCAGCGGCCCTTCCTGAAAGCGGAGCCCGACTGCCACGTGAGCGAGGAGGACACCCTGCCGCTGACG
CACTTTGAGGACAGCCCTGCCTACCTGCTGGAGGTGGAGCACTGCGGCAGCCTGCCCTACGCGGAGGGCTTTGCCTACT
GATG
CitationBrent AE, Tabin CJ. FGF acts directly on the somitic tendon progenitors through the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development. 2004 Aug;131(16):3885-96. Epub 2004 Jul 14.
CopyrightThis material is protected by copyright. The Company of Biologists' (publishers of Development) hold an Exclusive License obtained from the authors, who retain copyright.
CommentsAuthors said: probe was made for "chick Erm (RT-PCR product using primers 5′ ACGTCTAGACCGGCCCCAGCC-TGCCCG 3′ and 5′ ACGGAATTCATCAGTAGGCAAAG-CCCTCCG 3′)" This region was extracted from NCBI Acc# XM_422651.2.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
stage 20
Dermomyotome
 

Entry 3

GEISHA IdErm.Firnberg.2002Data SourcePublication
Complete cDNA Template Probeshow
CCGGCCCCAGCCTGCCCGGCCCCCCCGGCACGGCTTCCAGTCCCCCATGGGCATCAAGCAGGAGCCCCGGGACTACTGC
ATCGACTCAGAAGTGCCTAACTGCCAGTCCTCATATGTGAGAGGGGGCCTCTTCCCCAGCAGCCACGATGGATTCTCGT
ATGAAAAAGACACACGATTGTATTTTGATGACACGTGCGTGGTACCAGAGAGACTGGAGGGTAAGGTGAAGCAGGAGCC
CACCCTGTACCGTGAGGGCCCTCCCTACCAGCGGCGCGGGTCGCTGCAGCTCTGGCAGTTCCTCGTCACGCTCCTGGAC
GACCCCGCCAACGCTCACTTCATCGCCTGGACCGGCCGCGGCATGGAGTTCAAGCTGATCGAGCCCGAGGAGGTAGCAC
GGCGCTGGGGCATCCAGAAGAACCGGCCGGCCATGAACTACGACAAGCTGAGCCGCTCCCTGCGCTACTACTACGAGAA
GGGCATCATGCAGAAGGTGGCCGGCGAGCGGTACGTCTACAAGTTTGTGTGTGACCCCGACGCCCTCTTCTCCATGGCG
TACCCCGACAATCAGCGGCCCTTCCTGAAAGCGGAGCCCGACTGCCACGTGAGCGAGGAGGACACCCTGCCGCTGACGC
ACTTTGAGGACAGCCCTGCCTACCTGCTGGAGGTGGAGCACTGCGGCAGCCTGCCCTACGCGGAGGGCTTTGCCTACTG
ATGGCCGGCTGGCGGAGCGACCAGCGCTAGCACGCACGTCTGCTGGGGGCCAACAAGGGCAAAGGTTTTGTAAAGAGTA
TTTTTTTGCCATTTCTTTTAACAGTGAAACACAACAACAAAAAAAAAAAAAAAAAAAA
CitationFirnberg N, Neubüser A (2005).FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal region. Dev Biol. 2002 Jul 15;247(2):237-50.
Copyright"Reprinted from Developmental Biology, 247(2), Firnberg N, Neubüser A, FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal region, 237-50., Copyright (2002), with permission from Elsevier". Copyright © (2002) Elsevier B.V. All rights reserved.
CommentsAccording to authors, "The plasmids used to prepare the antisense riboprobes employed in this study have previously been described: (refs)." As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # AF075706).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Face Mesenchyme
Forebrain
Nasal Placode/Nerve
 
19-24
stage 24
Face Mesenchyme
Forebrain
Nasal Placode/Nerve
Surface Ectoderm
 
31-44
stage 44
Forebrain
 

Entry 4

GEISHA IdERM.Blentic.2008Data SourcePublication
Complete cDNA Template Probeshow
ATGGACGGCTTCTACGACCAGCAGGTCCCCTTCATGGGCCCTGGGAAATCCTGTGCCGAGGAGGGCCGAGGCCGGTTGG
GCTCCGAGAGGAAAAGGAAGTTTTTGGAGACCGACCTGGCCCACGACTCGGAAGAGCTCTTCCAGGATCTCAGCCAGCT
GCAGGAGGCCTGGCTAGCTGAAGCTCAGGTCCCCGACGATGAACAATTTGTCCCAGATTTCCAGTCTGACAACCTGGTC
CTGCATGCCCCACCTCCAGCCAAGATCAAGCGGGAGCTGCACAGCCCTTCCTCAGAGCTGTCGGCCTGCAGCCACGAGC
AGGCTCTCTGTGCCAGCTACGGAGACAAGTGCCTCTACAACTGCTGTGCCTACGACAGGAAGCCCCCCGCTGGGTTCAA
GCCATTAACACCGCCCGCCACGCCGGTGTCCCCCGCGCAGCCGGGCTCGTCCCTGCCACCGCCGCCGGCCCCAGGAGTG
CAGGCAGCTGCCCATGGCGGCCCAGCTGCCCCACTGCGCAGCACCGCGCCGGCACCACACCTGCTGCAGGAGCAGAGGC
AGCAAACCTTCGCCGTGCCGCGGCCGCCCCACCCGCCCGTGCACATGCCAAAGATGATGTCCGAAAACCAATACCCTAC
AGAGCACAGGTTCCAAAGGCAGATGTCTGAGCCCTGCCACCCCTTCCCACCACAACCCGGCGTTCCCGGGGACAGCCGC
CCCGTCTACCACCGGCAGCTGTCGGAACCCGTTGGCCCCACCGCCCCCCACCCCGCTCAGGGATTCAAACAGGAGTACC
ACGACCCGCTCTATGAGCACGCCGGCCCCAGCCTGCCCGGCCCCCCCGGGCACGGCTTCCAGTCCCCCATGGGCATCAA
GCAGGAGCCCCGGGACTACTGCATCGACTCAGAAGTGCCTAACTGCCAGTCCTCATATGTGAGAGGGGGCCTCTTCCCC
AGCAGCCACGATGGATTCTCGTATGAAAAAGACACACGATTGTATTTTGATGACACGTGCGTGGTACCAGAGAGACTGG
AGGGTAAGGTGAAGCAGGAGCCCACCCTGTACCGCGAGGGCCCTCCCTACCAGCGGCGTGGGTCGCTGCAGCTCTGGCA
GTTCCTCGTCACGCTCCTGGACGACCCCGCCAACGCTCACTTCATCGCCTGGACCGGCCGCGGCATGGAGTTCAAGCTG
ATCGAGCCCGAGGAGGTAGCACGGCGCTGGGGCATCCAGAAGAACCGGCCGGCCATGAACTACGACAAGCTGAGCCGCT
CCCTGCGCTACTACTACGAGAAGGGCATCATGCAGAAGGTGGCCGGCGAGCGGTACGTCTACAAGTTCGTGTGTGACCC
CGATGCCCTCTTCTCCATGGCGTACCCCGACAATCAGCGGCCCTTCCTGAAAGCGGAGCCCGACTGCCACGTGAGCGAG
GAGGACACCCTGCCGCTGACGCACTTTGAGGACAGCCCTGCCTACCTGCTGGAGGTGGAGCACTGCGGCAGCCTGCCCT
ACGCGGAGGGCTTTGCCTACTGATGGCCGGCTGGCGGAGCAACCAGCGCTAGCACGCACGTCTGCTGGGGGCCAACAAG
GGCAAAGGTTTTGTAAAGAGTATTTTTTTGCCATTTCTTTTAACAGTGAAACACAACAACAAAAAAAAAAA
CitationBlentic A, Tandon P, Payton S, Walshe J, Carney T, Kelsh RN, Mason I, Graham A. The emergence of ectomesenchyme. Dev Dyn. 2008 Mar;237(3):592-601.
CopyrightCopyright © 2008 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #XM_422651).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Ear/Otic Placode
Forebrain
Hindbrain
Isthmus/MHB
 

Entry 5

GEISHA IdERM.Maier.2010Data SourcePublication
Complete cDNA Template Probeshow
ATGGACGGCTTCTACGACCAGCAGGTCCCCTTCATGGGCCCTGGGAAATCCTGTGCCGAGGAGGGCCGAGGCCGGTTGG
GCTCCGAGAGGAAAAGGAAGTTTTTGGAGACCGACCTGGCCCACGACTCGGAAGAGCTCTTCCAGGATCTCAGCCAGCT
GCAGGAGGCCTGGCTAGCTGAAGCTCAGGTCCCCGACGATGAACAATTTGTCCCAGATTTCCAGTCTGACAACCTGGTC
CTGCATGCCCCACCTCCAGCCAAGATCAAGCGGGAGCTGCACAGCCCTTCCTCAGAGCTGTCGGCCTGCAGCCACGAGC
AGGCTCTCTGTGCCAGCTACGGAGACAAGTGCCTCTACAACTGCTGTGCCTACGACAGGAAGCCCCCCGCTGGGTTCAA
GCCATTAACACCGCCCGCCACGCCGGTGTCCCCCGCGCAGCCGGGCTCGTCCCTGCCACCGCCGCCGGCCCCAGGAGTG
CAGGCAGCTGCCCATGGCGGCCCAGCTGCCCCACTGCGCAGCACCGCGCCGGCACCACACCTGCTGCAGGAGCAGAGGC
AGCAAACCTTCGCCGTGCCGCGGCCGCCCCACCCGCCCGTGCACATGCCAAAGATGATGTCCGAAAACCAATACCCTAC
AGAGCACAGGTTCCAAAGGCAGATGTCTGAGCCCTGCCACCCCTTCCCACCACAACCCGGCGTTCCCGGGGACAGCCGC
CCCGTCTACCACCGGCAGCTGTCGGAACCCGTTGGCCCCACCGCCCCCCACCCCGCTCAGGGATTCAAACAGGAGTACC
ACGACCCGCTCTATGAGCACGCCGGCCCCAGCCTGCCCGGCCCCCCCGGGCACGGCTTCCAGTCCCCCATGGGCATCAA
GCAGGAGCCCCGGGACTACTGCATCGACTCAGAAGTGCCTAACTGCCAGTCCTCATATGTGAGAGGGGGCCTCTTCCCC
AGCAGCCACGATGGATTCTCGTATGAAAAAGACACACGATTGTATTTTGATGACACGTGCGTGGTACCAGAGAGACTGG
AGGGTAAGGTGAAGCAGGAGCCCACCCTGTACCGCGAGGGCCCTCCCTACCAGCGGCGTGGGTCGCTGCAGCTCTGGCA
GTTCCTCGTCACGCTCCTGGACGACCCCGCCAACGCTCACTTCATCGCCTGGACCGGCCGCGGCATGGAGTTCAAGCTG
ATCGAGCCCGAGGAGGTAGCACGGCGCTGGGGCATCCAGAAGAACCGGCCGGCCATGAACTACGACAAGCTGAGCCGCT
CCCTGCGCTACTACTACGAGAAGGGCATCATGCAGAAGGTGGCCGGCGAGCGGTACGTCTACAAGTTCGTGTGTGACCC
CGATGCCCTCTTCTCCATGGCGTACCCCGACAATCAGCGGCCCTTCCTGAAAGCGGAGCCCGACTGCCACGTGAGCGAG
GAGGACACCCTGCCGCTGACGCACTTTGAGGACAGCCCTGCCTACCTGCTGGAGGTGGAGCACTGCGGCAGCCTGCCCT
ACGCGGAGGGCTTTGCCTACTGATGGCCGGCTGGCGGAGCAACCAGCGCTAGCACGCACGTCTGCTGGGGGCCAACAAG
GGCAAAGGTTTTGTAAAGAGTATTTTTTTGCCATTTCTTTTAACAGTGAAACACAACAACAAAAAAAAAAA
CitationMaier, E, von Hofsten, J, Nord, H, Fernandes, M, Paek, H, Hebert, JM, Gunhaga, L, Opposing Fgf and Bmp activities regulate the specification of olfactory sensory and respiratory epithelial cell fates. Development. 2010 May 15; 137(10): 1601–1611.
CopyrightCopyright © 2010. Held by the authors. Requested
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # XM_422651.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
stage 22
Nasal Placode/Nerve
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1104

Mouse

EmageMGI:1096867
EurexpressMGI:1096867
MGI GXDMGI:1096867

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-9572, ZDB-GENE-991228-4
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona