GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

EYA2
EYA transcriptional coactivator and phosphatase 2

Gene
Official SymbolEYA2
Official Full NameEYA transcriptional coactivator and phosphatase 2
CGNC ID49455
also known aseyes absent homolog 2|eyes absent 2, eyes absent homolog 2 , eya2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204915
PolypeptideNP_990246
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1839
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2139ENSG00000064655MIM:601654
Mouse14049ENSMUSG00000017897MGI:109341
Xenopus100037919487843
Zebrafish447819ENSDARG00000018984ZDB-GENE-040912-24ZFIN:ZDB-GENE-040912-24
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395745
Ensembl GeneENSGALG00000004508
KEGGgga:395745

Entry 1

GEISHA IdEYA2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGCTGACAGTGAGATTGAGCGTG
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGTGTGCTTTTTTGCCCCCTGcDNA Template Length755
Forward cDNA Template Probeshow
CCCCTCACACCATCTCCTATTACAATGGTACACGGGGCTTTCCTTCCAAACCTTTGCATTATTCTTTCAAAACAGCTCT
CTTTTCCTGTTTTTGTTGCACTGTAGATGTTTTCGATTGGGAAGACAGTGCCTAGTCCATAGAGAAGCACTTTTGCCAG
AGCTGGTATCAGTTGAGTTGTGGTTACCAACACATTTACACAGTTAGGCCGGGAATGTATCAAATTCAGTGCCTTCAGA
GCATGTGTGAGCCAGAGATCAGTCAGCGCTTCGAGTTCTGCTCTTAACTGCAGCCAGGTTTCCCTCTTAGGAGCTCCTA
TTAAACCCCCAACATTGTTTTTGTAGGTGTTGTACATCTCTTTCACCCGACGGTAGCGGAATGCTAATTTCCTCATCCA
GTCAACTCCCCCATGAACGCCTGAGCCCAGACATAGATTTGCACTGGCAGCTGAACTGTGAAAGCCATCTGCAGAGAAG
TTATACGTGCTTAGATCTTGACCATTGTCATCTGATGATACATCATCTATGTGGATCTGGTCACAGTCCTCCAGGTCAT
TAAAGAACAGATGTGTATCTGCAAGGTTGAAGATCATTTCTTCCATCATAAGACCTATCCGCACAGACGTTGTCGTGTC
CTTCCCATATCTGGATGCAAAGGTTCCCGTGAGTAAGGAGTGAAAAATAATTATCGTCTCATCCAAATCCCACACAAAT
ACACGCTCAATCTCCNGGTCANCCAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Ectoderm
Neural Plate/Tube
 
7-12
stage 8
stage 8
stage 9
stage 9
stage 10
stage 10
stage 10
stage 10
stage 11
stage 11
stage 11
stage 11
Ear/Otic Placode
Extraembryonic
Head Mesenchyme
Neural Crest
Neural Plate/Tube
Somites
Dorsal view.
Ventral view.
13-18
stage 16
Ectoderm
Eye
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Spinal Ganglia and Nerves
Low level expression in the Spinal Ganglia and Nerves.
19-24
stage 22
stage 22
Ear/Otic Placode
Eye
Leg Mesenchyme
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Spinal Ganglia and Nerves
Tail
Wing Mesenchyme
 
25
stage 25
stage 25
Ear/Otic Placode
Eye
Leg Mesenchyme
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Spinal Ganglia and Nerves
Wing Mesenchyme
 

Entry 2

GEISHA IdEYA2.Barembaum.2007Data SourcePublication
Complete cDNA Template Probeshow
CGCTGCGAGGCGACGCGGCCCCACGCGTGCGGTATAAGGAAATGCTAGATCTAGTGATATCACCCAGCCTGACTGTAAA
TAAAGAGTGCCCTGACAGACTGAAGCTTAACCTTACTAACATTTATGCCACGGCTCCAGATGACATAGAAGGCAACAGT
AAAGCAGCACCACAGTGTCCTCTCCATCTTTACTCAACAAAACGTTATCCCCATATAGTGACAGTCCAGTCTTTCCCAA
CAATGGCAACGTATGGACAGACTCAGTACAGTGCAGGAATCCAACAGGCTGCTGCATACACTGCCTACCCTCCTCCAGC
GCAGCCCTACGGCATACCTTCCTACAGCATCAAAACAGAGGACAGCTTGAGCCATTCCCCAGGACAGAGTGGGTTTCTT
AGTTATGGATCCAGTTTCAGTACCCCGACTGCTGGACAAGCACCGTATACCTACCAGATGCATGGCACAACAGGGATTT
ACCAGGGAGCCAATGGCCTGACAAATTCTGCTGGATTCAGTGCTGTGCATCAGGAATATTCATCATACCCAAGCTTTCC
TCAAAGCCAGTACTCACAGTATTACAGTTCCTCCTACAACTCTCCCTACATGTCCACAAACAGCATCAGCCCTTCAGCC
ATCCCAACCTCCACTTATTCTCTGCAGGAGTCTTCTCACAACATCACCAGTCAGAGCACAGAATCGCTGTCTGGAGAAT
ATGGAACAACACCAGCAAAAGATATAGAAACAGACAGACATCACAGAGGGTCGGATGGCAAGGTACGAGCCCGATCAAA
AAGAAGCAACGATCCTTCCCCCACTGCTGACAGTGAGATTGAGCGTGTATTTGTGTGGGATTTGGATGAGACGATAATT
ATTTTTCACTCCTTACTCACGGGAACCTTTGCATCCAGATATGGGAAGGACACAACAACGTCTGTGCGGATAGGTCTTA
TGATGGAAGAAATGATCTTCAACCTTGCAGATACACATCTGTTCTTTAATGACCTGGAGGACTGTGACCAGATCCACAT
AGATGATGTATCATCAGATGACAATGGTCAAGATCTAAGCACGTATAACTTCTCTGCAGATGGCTTTCACAGTTCAGCT
GCCAGTGCAAATCTATGTCTGGGCTCAGGCGTTCATGGGGGAGTTGACTGGATGAGGAAATTAGCATTCCGCTACCGTC
GGGTGAAAGAGATGTACAACACCTACAAAAACAATGTTGGGGGTTTAATAGGAGCTCCTAAGAGGGAAACCTGGCTGCA
GTTAAGAGCAGAACTCGAAGCGCTGACTGATCTCTGGCTCACACATGCTCTGAAGGCACTGAATTTGATACATTCCCGG
CCTAACTGTGTAAATGTGTTGGTAACCACAACTCAACTGATACCAGCTCTGGCAAAAGTGCTTCTCTATGGACTAGGCA
CTGTCTTCCCAATCGAAAACATCTACAGTGCAACAAAAACAGGAAAAGAGAGCTGTTTTGAAAGAATAATGCAAAGGTT
TGGAAGGAAAGCCGTGTACATTGTAATAGGAGATGGTGTTGAAGAGGAACAGGGGGCAAAAAAGCACAACATGCCATTC
TGGAGAATCTCTTGTCATGCTGACCTGGAAGCTCTTCGGCACGCCTTGGAACTTGAATATTTGTAGCAGACCCCAACAT
CTTAGCACTGTGAGGGCTTCACTCAAACTGTTACATCGGTTCCACCTATTCCTCAGCATTTTCTTATTAAAAAATCCCA
CAGCAACTGCAGTTTTTCTTTTTTTGAAGGAGAACCCTTTCAGTGGAAGCCTCTAAGGACTTGCAGCCAAAGAACATTC
TATCAACTCCTTCCTTTGAACAGAGGAAAAGCCTTCAGATAACTCTGGGGACCCTGCAGTTACATGCTTAAGCTGGGTG
CACAGAGCCGTAAATACCCTTTGGCCATCAACAAGAACCCCCAGAAGCCTTGGGTCTACTTGTCAGTTTTCTTGCTTTT
CAAAGGGGAAGAGGAAATATTAAAGACTGTGAGCATACTCTGTGCATAATACATCATATCACGTCGGACCTTCTGCAAA
TAAGAGTGAAACTGTTGATTTTTTTGTTTGTATTTTTTTTTAATTTATGAACTAATCTCATTACTCTGGTATTAAGCTC
TGTACCTGTGTTTTTAATCTGGCTTTTTGGGGTGGGTGGGTGGGCAAAATCCTGCCATTCTAAATTAAGAATTCATTCT
TCCAGGACAGTATCTGGAGAAAATCATATTGTGTACATTTATAATAAGGACACATGGGACTATTGGTAAGAACTATAGC
TGCATTTTTAAATCCTACATGGATGGTCTGTGGATTGTGCATGTGTCTACACGGTGCCTTATGCTGCCATCTCAGTTTG
GGTGGGAAAAAAGTACCCTGTGATGAGTGAAAGGCATTAAATAAAAAAGAAAGTTTACAAAAAAAAAAAAAAAAAA
CitationBarembaum M, Bronner-Fraser M. Spalt4 mediates invagination and otic placode gene expression in cranial ectoderm. Development. 2007 Nov;134(21):3805-14.
CopyrightPublished by The Company of Biologists 2007
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204915).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-5
stage 5
stage 5
Ectoderm
Preplacode Ectoderm

Entry 3

GEISHA IdEYA2.McLarren.2003Data SourcePublication
Complete cDNA Template Probeshow
CGCTGCGAGGCGACGCGGCCCCACGCGTGCGGTATAAGGAAATGCTAGATCTAGTGATATCACCCAGCCTGACTGTAAA
TAAAGAGTGCCCTGACAGACTGAAGCTTAACCTTACTAACATTTATGCCACGGCTCCAGATGACATAGAAGGCAACAGT
AAAGCAGCACCACAGTGTCCTCTCCATCTTTACTCAACAAAACGTTATCCCCATATAGTGACAGTCCAGTCTTTCCCAA
CAATGGCAACGTATGGACAGACTCAGTACAGTGCAGGAATCCAACAGGCTGCTGCATACACTGCCTACCCTCCTCCAGC
GCAGCCCTACGGCATACCTTCCTACAGCATCAAAACAGAGGACAGCTTGAGCCATTCCCCAGGACAGAGTGGGTTTCTT
AGTTATGGATCCAGTTTCAGTACCCCGACTGCTGGACAAGCACCGTATACCTACCAGATGCATGGCACAACAGGGATTT
ACCAGGGAGCCAATGGCCTGACAAATTCTGCTGGATTCAGTGCTGTGCATCAGGAATATTCATCATACCCAAGCTTTCC
TCAAAGCCAGTACTCACAGTATTACAGTTCCTCCTACAACTCTCCCTACATGTCCACAAACAGCATCAGCCCTTCAGCC
ATCCCAACCTCCACTTATTCTCTGCAGGAGTCTTCTCACAACATCACCAGTCAGAGCACAGAATCGCTGTCTGGAGAAT
ATGGAACAACACCAGCAAAAGATATAGAAACAGACAGACATCACAGAGGGTCGGATGGCAAGGTACGAGCCCGATCAAA
AAGAAGCAACGATCCTTCCCCCACTGCTGACAGTGAGATTGAGCGTGTATTTGTGTGGGATTTGGATGAGACGATAATT
ATTTTTCACTCCTTACTCACGGGAACCTTTGCATCCAGATATGGGAAGGACACAACAACGTCTGTGCGGATAGGTCTTA
TGATGGAAGAAATGATCTTCAACCTTGCAGATACACATCTGTTCTTTAATGACCTGGAGGACTGTGACCAGATCCACAT
AGATGATGTATCATCAGATGACAATGGTCAAGATCTAAGCACGTATAACTTCTCTGCAGATGGCTTTCACAGTTCAGCT
GCCAGTGCAAATCTATGTCTGGGCTCAGGCGTTCATGGGGGAGTTGACTGGATGAGGAAATTAGCATTCCGCTACCGTC
GGGTGAAAGAGATGTACAACACCTACAAAAACAATGTTGGGGGTTTAATAGGAGCTCCTAAGAGGGAAACCTGGCTGCA
GTTAAGAGCAGAACTCGAAGCGCTGACTGATCTCTGGCTCACACATGCTCTGAAGGCACTGAATTTGATACATTCCCGG
CCTAACTGTGTAAATGTGTTGGTAACCACAACTCAACTGATACCAGCTCTGGCAAAAGTGCTTCTCTATGGACTAGGCA
CTGTCTTCCCAATCGAAAACATCTACAGTGCAACAAAAACAGGAAAAGAGAGCTGTTTTGAAAGAATAATGCAAAGGTT
TGGAAGGAAAGCCGTGTACATTGTAATAGGAGATGGTGTTGAAGAGGAACAGGGGGCAAAAAAGCACAACATGCCATTC
TGGAGAATCTCTTGTCATGCTGACCTGGAAGCTCTTCGGCACGCCTTGGAACTTGAATATTTGTAGCAGACCCCAACAT
CTTAGCACTGTGAGGGCTTCACTCAAACTGTTACATCGGTTCCACCTATTCCTCAGCATTTTCTTATTAAAAAATCCCA
CAGCAACTGCAGTTTTTCTTTTTTTGAAGGAGAACCCTTTCAGTGGAAGCCTCTAAGGACTTGCAGCCAAAGAACATTC
TATCAACTCCTTCCTTTGAACAGAGGAAAAGCCTTCAGATAACTCTGGGGACCCTGCAGTTACATGCTTAAGCTGGGTG
CACAGAGCCGTAAATACCCTTTGGCCATCAACAAGAACCCCCAGAAGCCTTGGGTCTACTTGTCAGTTTTCTTGCTTTT
CAAAGGGGAAGAGGAAATATTAAAGACTGTGAGCATACTCTGTGCATAATACATCATATCACGTCGGACCTTCTGCAAA
TAAGAGTGAAACTGTTGATTTTTTTGTTTGTATTTTTTTTTAATTTATGAACTAATCTCATTACTCTGGTATTAAGCTC
TGTACCTGTGTTTTTAATCTGGCTTTTTGGGGTGGGTGGGTGGGCAAAATCCTGCCATTCTAAATTAAGAATTCATTCT
TCCAGGACAGTATCTGGAGAAAATCATATTGTGTACATTTATAATAAGGACACATGGGACTATTGGTAAGAACTATAGC
TGCATTTTTAAATCCTACATGGATGGTCTGTGGATTGTGCATGTGTCTACACGGTGCCTTATGCTGCCATCTCAGTTTG
GGTGGGAAAAAAGTACCCTGTGATGAGTGAAAGGCATTAAATAAAAAAGAAAGTTTACAAAAAAAAAAAAAAAAAA
CitationMcLarren KW, Litsiou A, Streit A. DLX5 positions the neural crest and preplacode region at the border of the neural plate. Dev Biol. 2003 Jul 1;259(1):34-47.
CopyrightCopyright © 2003 Elsevier Science (USA). All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204915).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7
stage 7
stage 7
Ectoderm
Neural Plate/Tube
Neural folds.
Nonneural Ectoderm

Entry 4

GEISHA IdEYA2.Bailey.2006Data SourcePublication
Complete cDNA Template Probeshow
CGCTGCGAGGCGACGCGGCCCCACGCGTGCGGTATAAGGAAATGCTAGATCTAGTGATATCACCCAGCCTGACTGTAAA
TAAAGAGTGCCCTGACAGACTGAAGCTTAACCTTACTAACATTTATGCCACGGCTCCAGATGACATAGAAGGCAACAGT
AAAGCAGCACCACAGTGTCCTCTCCATCTTTACTCAACAAAACGTTATCCCCATATAGTGACAGTCCAGTCTTTCCCAA
CAATGGCAACGTATGGACAGACTCAGTACAGTGCAGGAATCCAACAGGCTGCTGCATACACTGCCTACCCTCCTCCAGC
GCAGCCCTACGGCATACCTTCCTACAGCATCAAAACAGAGGACAGCTTGAGCCATTCCCCAGGACAGAGTGGGTTTCTT
AGTTATGGATCCAGTTTCAGTACCCCGACTGCTGGACAAGCACCGTATACCTACCAGATGCATGGCACAACAGGGATTT
ACCAGGGAGCCAATGGCCTGACAAATTCTGCTGGATTCAGTGCTGTGCATCAGGAATATTCATCATACCCAAGCTTTCC
TCAAAGCCAGTACTCACAGTATTACAGTTCCTCCTACAACTCTCCCTACATGTCCACAAACAGCATCAGCCCTTCAGCC
ATCCCAACCTCCACTTATTCTCTGCAGGAGTCTTCTCACAACATCACCAGTCAGAGCACAGAATCGCTGTCTGGAGAAT
ATGGAACAACACCAGCAAAAGATATAGAAACAGACAGACATCACAGAGGGTCGGATGGCAAGGTACGAGCCCGATCAAA
AAGAAGCAACGATCCTTCCCCCACTGCTGACAGTGAGATTGAGCGTGTATTTGTGTGGGATTTGGATGAGACGATAATT
ATTTTTCACTCCTTACTCACGGGAACCTTTGCATCCAGATATGGGAAGGACACAACAACGTCTGTGCGGATAGGTCTTA
TGATGGAAGAAATGATCTTCAACCTTGCAGATACACATCTGTTCTTTAATGACCTGGAGGACTGTGACCAGATCCACAT
AGATGATGTATCATCAGATGACAATGGTCAAGATCTAAGCACGTATAACTTCTCTGCAGATGGCTTTCACAGTTCAGCT
GCCAGTGCAAATCTATGTCTGGGCTCAGGCGTTCATGGGGGAGTTGACTGGATGAGGAAATTAGCATTCCGCTACCGTC
GGGTGAAAGAGATGTACAACACCTACAAAAACAATGTTGGGGGTTTAATAGGAGCTCCTAAGAGGGAAACCTGGCTGCA
GTTAAGAGCAGAACTCGAAGCGCTGACTGATCTCTGGCTCACACATGCTCTGAAGGCACTGAATTTGATACATTCCCGG
CCTAACTGTGTAAATGTGTTGGTAACCACAACTCAACTGATACCAGCTCTGGCAAAAGTGCTTCTCTATGGACTAGGCA
CTGTCTTCCCAATCGAAAACATCTACAGTGCAACAAAAACAGGAAAAGAGAGCTGTTTTGAAAGAATAATGCAAAGGTT
TGGAAGGAAAGCCGTGTACATTGTAATAGGAGATGGTGTTGAAGAGGAACAGGGGGCAAAAAAGCACAACATGCCATTC
TGGAGAATCTCTTGTCATGCTGACCTGGAAGCTCTTCGGCACGCCTTGGAACTTGAATATTTGTAGCAGACCCCAACAT
CTTAGCACTGTGAGGGCTTCACTCAAACTGTTACATCGGTTCCACCTATTCCTCAGCATTTTCTTATTAAAAAATCCCA
CAGCAACTGCAGTTTTTCTTTTTTTGAAGGAGAACCCTTTCAGTGGAAGCCTCTAAGGACTTGCAGCCAAAGAACATTC
TATCAACTCCTTCCTTTGAACAGAGGAAAAGCCTTCAGATAACTCTGGGGACCCTGCAGTTACATGCTTAAGCTGGGTG
CACAGAGCCGTAAATACCCTTTGGCCATCAACAAGAACCCCCAGAAGCCTTGGGTCTACTTGTCAGTTTTCTTGCTTTT
CAAAGGGGAAGAGGAAATATTAAAGACTGTGAGCATACTCTGTGCATAATACATCATATCACGTCGGACCTTCTGCAAA
TAAGAGTGAAACTGTTGATTTTTTTGTTTGTATTTTTTTTTAATTTATGAACTAATCTCATTACTCTGGTATTAAGCTC
TGTACCTGTGTTTTTAATCTGGCTTTTTGGGGTGGGTGGGTGGGCAAAATCCTGCCATTCTAAATTAAGAATTCATTCT
TCCAGGACAGTATCTGGAGAAAATCATATTGTGTACATTTATAATAAGGACACATGGGACTATTGGTAAGAACTATAGC
TGCATTTTTAAATCCTACATGGATGGTCTGTGGATTGTGCATGTGTCTACACGGTGCCTTATGCTGCCATCTCAGTTTG
GGTGGGAAAAAAGTACCCTGTGATGAGTGAAAGGCATTAAATAAAAAAGAAAGTTTACAAAAAAAAAAAAAAAAAA
CitationBailey AP, Bhattacharyya S, Bronner-Fraser M, Streit A. Lens specification is the ground state of all sensory placodes, from which FGF promotes olfactory identity. Dev Cell. 2006 Oct;11(4):505-17.
CopyrightCopyright © 2006, Elsevier
CommentsInsufficient information provided in publication to verify exact sequence to synthesize probe. Sequence below was obtained from NCBI (NM_204915).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
Nasal Placcode/Nerve
 
19-20
stage 20
  

Entry 5

GEISHA IdEYA2.Litsiou.2005Data SourcePublication
Complete cDNA Template Probeshow
CGCTGCGAGGCGACGCGGCCCCACGCGTGCGGTATAAGGAAATGCTAGATCTAGTGATATCACCCAGCCTGACTGTAAA
TAAAGAGTGCCCTGACAGACTGAAGCTTAACCTTACTAACATTTATGCCACGGCTCCAGATGACATAGAAGGCAACAGT
AAAGCAGCACCACAGTGTCCTCTCCATCTTTACTCAACAAAACGTTATCCCCATATAGTGACAGTCCAGTCTTTCCCAA
CAATGGCAACGTATGGACAGACTCAGTACAGTGCAGGAATCCAACAGGCTGCTGCATACACTGCCTACCCTCCTCCAGC
GCAGCCCTACGGCATACCTTCCTACAGCATCAAAACAGAGGACAGCTTGAGCCATTCCCCAGGACAGAGTGGGTTTCTT
AGTTATGGATCCAGTTTCAGTACCCCGACTGCTGGACAAGCACCGTATACCTACCAGATGCATGGCACAACAGGGATTT
ACCAGGGAGCCAATGGCCTGACAAATTCTGCTGGATTCAGTGCTGTGCATCAGGAATATTCATCATACCCAAGCTTTCC
TCAAAGCCAGTACTCACAGTATTACAGTTCCTCCTACAACTCTCCCTACATGTCCACAAACAGCATCAGCCCTTCAGCC
ATCCCAACCTCCACTTATTCTCTGCAGGAGTCTTCTCACAACATCACCAGTCAGAGCACAGAATCGCTGTCTGGAGAAT
ATGGAACAACACCAGCAAAAGATATAGAAACAGACAGACATCACAGAGGGTCGGATGGCAAGGTACGAGCCCGATCAAA
AAGAAGCAACGATCCTTCCCCCACTGCTGACAGTGAGATTGAGCGTGTATTTGTGTGGGATTTGGATGAGACGATAATT
ATTTTTCACTCCTTACTCACGGGAACCTTTGCATCCAGATATGGGAAGGACACAACAACGTCTGTGCGGATAGGTCTTA
TGATGGAAGAAATGATCTTCAACCTTGCAGATACACATCTGTTCTTTAATGACCTGGAGGACTGTGACCAGATCCACAT
AGATGATGTATCATCAGATGACAATGGTCAAGATCTAAGCACGTATAACTTCTCTGCAGATGGCTTTCACAGTTCAGCT
GCCAGTGCAAATCTATGTCTGGGCTCAGGCGTTCATGGGGGAGTTGACTGGATGAGGAAATTAGCATTCCGCTACCGTC
GGGTGAAAGAGATGTACAACACCTACAAAAACAATGTTGGGGGTTTAATAGGAGCTCCTAAGAGGGAAACCTGGCTGCA
GTTAAGAGCAGAACTCGAAGCGCTGACTGATCTCTGGCTCACACATGCTCTGAAGGCACTGAATTTGATACATTCCCGG
CCTAACTGTGTAAATGTGTTGGTAACCACAACTCAACTGATACCAGCTCTGGCAAAAGTGCTTCTCTATGGACTAGGCA
CTGTCTTCCCAATCGAAAACATCTACAGTGCAACAAAAACAGGAAAAGAGAGCTGTTTTGAAAGAATAATGCAAAGGTT
TGGAAGGAAAGCCGTGTACATTGTAATAGGAGATGGTGTTGAAGAGGAACAGGGGGCAAAAAAGCACAACATGCCATTC
TGGAGAATCTCTTGTCATGCTGACCTGGAAGCTCTTCGGCACGCCTTGGAACTTGAATATTTGTAGCAGACCCCAACAT
CTTAGCACTGTGAGGGCTTCACTCAAACTGTTACATCGGTTCCACCTATTCCTCAGCATTTTCTTATTAAAAAATCCCA
CAGCAACTGCAGTTTTTCTTTTTTTGAAGGAGAACCCTTTCAGTGGAAGCCTCTAAGGACTTGCAGCCAAAGAACATTC
TATCAACTCCTTCCTTTGAACAGAGGAAAAGCCTTCAGATAACTCTGGGGACCCTGCAGTTACATGCTTAAGCTGGGTG
CACAGAGCCGTAAATACCCTTTGGCCATCAACAAGAACCCCCAGAAGCCTTGGGTCTACTTGTCAGTTTTCTTGCTTTT
CAAAGGGGAAGAGGAAATATTAAAGACTGTGAGCATACTCTGTGCATAATACATCATATCACGTCGGACCTTCTGCAAA
TAAGAGTGAAACTGTTGATTTTTTTGTTTGTATTTTTTTTTAATTTATGAACTAATCTCATTACTCTGGTATTAAGCTC
TGTACCTGTGTTTTTAATCTGGCTTTTTGGGGTGGGTGGGTGGGCAAAATCCTGCCATTCTAAATTAAGAATTCATTCT
TCCAGGACAGTATCTGGAGAAAATCATATTGTGTACATTTATAATAAGGACACATGGGACTATTGGTAAGAACTATAGC
TGCATTTTTAAATCCTACATGGATGGTCTGTGGATTGTGCATGTGTCTACACGGTGCCTTATGCTGCCATCTCAGTTTG
GGTGGGAAAAAAGTACCCTGTGATGAGTGAAAGGCATTAAATAAAAAAGAAAGTTTACAAAAAAAAAAAAAAAAAA
CitationLitsiou A, Hanson S, Streit A. A balance of FGF, BMP and WNT signalling positions the future placode territory in the head. Development. 2005 Sep;132(18):4051-62. Epub 2005 Aug 10
CopyrightAuthors hold the copyright. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_204915.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Early Endoderm
Early Mesoderm
Epiblast
Neural Crest
 
7-8
stage 7
stage 7
stage 7
stage 7
stage 8
stage 8
Early Endoderm
Early Mesoderm
Epiblast
Head Mesenchyme
Neural Crest
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1839

Mouse

EmageMGI:109341
EurexpressMGI:109341
MGI GXDMGI:109341

Frog

Xenbase487843

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040912-24
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona