GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ETV1
ETS variant 1

Gene
Official SymbolETV1
Official Full NameETS variant 1
CGNC ID8196
also known asER81, ETS translocation variant 1|ets domain protein|ets variant gene 1, ER81, ETV1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204917
PolypeptideNP_990248
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2999
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2115ENSG00000006468MIM:600541
Mouse14009ENSMUSG00000004151All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:99254
Xenopus394827, 398358489878
Zebrafish563876ENSDARG00000055183ZDB-GENE-070104-1ZFIN:ZDB-GENE-070104-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395748
Ensembl Gene
KEGGgga:395748

Entry 1

GEISHA IdEr81.Lunn.2007Data SourcePublication
Complete cDNA Template Probeshow
CTGCTTCCGAGGGGGAAGTGCCGGGGAATAATTAATGTTTTTATTAAATTTGGAGGGAAATTTTTTGCAGCCGATCGCC
GCGCGTGGCCTTCAGGCTGATTGGAGTCCAGATCCCGAGGAAATCTCCAGATCCAATGCCCACTAAATAAAACACTGAG
CTCAGACTCGTGGAAGAGCCACAGGATGGATGGATTTTATGACCAGCAAGTGCCTTACATGGTCACCAATAATCCGCGT
GGGAGAAACTGTAATGAGAGACCGACAAATGTCAGGAAAAGAAAATTCATTAACAGAGACCTGGCTCATGATTCAGAAG
AACTCTTTCAAGATCTGAGCCAATTACAGGAGACATGGCTTGCAGAAGCTCAGGTACCTGACAATGACGAGCAGTTTGT
GCCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGTCTCCCTGTGAAAATCAAGAAGGAACCCCATAGCCCATGTTCA
GAACTTGGCTCTGCTTGTAGTCAAGAGCAACCATTCAAGTTCAGTTATGGGGAAAAGTGCCTGTACAATGTCAGTGCCT
ATGATCAGAAGCCACAAGTGGGAATGAGGCCCTCCAACCCACCAACGCCATCCAGCACTCCTGTGTCACCACTGCACCA
TGCCTCCCCAAACTCAGCTCAGACTCCTAAACCTGACCGGGTTTTCCCTGCCCATCTCCCTCCATCCCAATCCATTCAA
GACAACAGCTTCCCTATGGACCACAGATTTCGCCGCCAGCTCTCTGAACCTTGCAATTCTTTTCCACCTTTGCCTGCAA
TGCCGAGGGAAGGACGTCCAATATATCAGCGGCAGATGTCTGAGCCTAACATCCCCTTCCCGCCTCAAGGTTTTAAGCA
GGAGTATCACGATCCAGTTTATGAACACAACGCCATGGTTGGCAGTGCAGCCAGTCAAAATTTCCCCCCTCCTCTGATG
ATTAAACAGGAACCTAGAGATTTTGCATATGATTCAGAAGTGCCTAGCTGCCATTCCATTTACATGAGGCAAGAAGGCT
TCCTGGCTCACCCAAACAGAACAGAAGGTTGTATGTATGAAAAGGGACCTAGGCAGTTTTATGATGACACTTGTGTTGT
TCCAGAGAAGTTTGACGGTGATGTCAAACAGGAACCAGGCATGTACCGTGAGGGACCCACATATCAACGGCGAGGCTCA
CTTCAGCTGTGGCAGTTCTTGGTAGCTCTTCTCGATGACCCATCAAACTCCCACTTCATAGCATGGACTGGCCGAGGCA
TGGAATTCAAGCTGATTGAGCCGGAGGAGGTGGCACGTCGCTGGGGGATTCAGAAAAATAGGCCAGCTATGAACTATGA
TAAACTTAGCCGATCACTTCGCTATTATTATGAAAAGGGAATCATGCAAAAGGTTGCTGGAGAAAGATACGTCTACAAG
TTCGTTTGTGACCCTGAAGCGCTTTTCTCCATGGCCTTTCCAGACAACCAGCGCCCCTTACTGAAGACTGACATGGAGC
GCCACATCAATGAGGAGGACACTGTTCCCCTGTCCCACTTTGACGAGAGCATGGTCTACATGCAGGATAGTGGCTGCTG
CAACACCCACCCATATAATGAAGGCTACGTCTATTAACAACAGTGACAGTAAAGGGGGTGTTTTCCCCTCTCTTANGCT
TCTCCTCTTTCACAAAGAANCCAGAAGAAAGCTGAATCGACTTCAGTTTGTTTTTTAAATAGTACACTAAAAGGGGCTT
TTCCTGTTGCATTATTCCTATGGTCTGCCATGGACAGCGCACTTTATTTGAAAGGGGAGGGTTGGAAACTAAACATTAT
TGTGTGTAACAGGAGGAAAAGGGTGGGTTTGCTTTTTATTAAGTTTGGGAAGGGAACATACAGGTTTTAAGTACAAAAA
AGCTATATCATGTCTGTTTTGTTTCATATCAACATAAGATATTGTACATTTTCTCTGGGTATCCGTAGTACAGTTAATT
CTCATTGTGCAAAATAACCACTTGCTGATAATATCAGCACAGCATGCCTAGGGCAGTTGTTTCTTGCCATTCTTAATTG
TCTTTCTGCAGATATAAAAGAGAAGCAAAGCGTATACTGCAGCATTTAATTTAGAAATTTGAAGTGGTGGACCTTGCAG
CTTGCCTCCGAAAGCAAACAAATATCTCTAGAGTTTTACTTTGTTTGTTTGTTTGTTTGAAGGGCCTCAAAAAATAAAA
TCCCACTTATTTACAGAGTAGTCTTAAGAACAAGGACTAAGTCACAAAATCCCTGACTTCAGACTGCAAGCTGCATGCT
GTAACTGTTGCTATACATATATGGCCAGTGCTATCACTTGGACATTCCAAGATCCATNTGAGAGTAGTAATTACATGTG
ATAGGCTGTCTGATGATCATGTCAGCATTAAATACGGGATCATGATCAGGACGGAGAAAACTTTCGTATCCTTCCTTTC
CTTTGGTACATAAATAAGTTATTTAATCAATAGGAATTAACTGTACTAAGTCACATATCTAATTATGCTGTTTAGACAC
AGCAAGCACTCCTTGAGAAAAATATCCAATACACTAAATAGGTACTTTAGTAATTTTTAGACATGGTACCCATTAATAT
GCATTTAAACCTTTTACTGCTGTGTTATGTTGATAACATATATAAATACTAGATAATGCTAATGCTTCTGCTGCTGTCT
TTGTCTGTAATATTCTCTTTGATGCTGAATTTACTATGACCATTTATAAGCAATGCTGTAACTACAGGTAGCATTTCAG
GACAAAATAGATGACTTGAACCATTTATTGCTTAGAAAATAGCTTACGCCATAGCTGTGCTATAAGCAGCTTTTATGCG
CATCCACAAATGACTAGTAAGCTTCAGCTTGCTGAGGAAAGCTCTGCAGAACCTTTTGTGATATTCGGTGGAACAGAGA
GTAGACGAACTGTCAATACCATGAAGTCGCTGTATGACATTGTAGTGCTGGCACTGATGTTACCAATCAACTTGTTTTG
GACACTAAATGTAAATGTGATCAG
CitationLunn JS, Fishwick KJ, Halley PA, Storey KG. A spatial and temporal map of FGF/Erk1/2 activity and response repertoires in the early chick embryo. Dev Biol. 2007 Feb 15;302(2):536-52. Epub 2006 Oct 14.
CopyrightCopyright © 2006 Elsevier Inc. All rights reserved.
CommentsInsufficient information in publication to verify exact sequence used to synthesize probe. Sequence above was obtained from NCBI (acc #NM_204917.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
Unlabeled
 
4-6
stage 4
stage 5
stage 6
Hensen's Node
Primitive Streak
 
7-10
stage 8
stage 10
stage 10
Forebrain
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
Precardiac Mesoderm

Entry 2

GEISHA IdETV1.Anderson.2020Data SourceDirect Submission
Complete cDNA Template Probeshow
CTGCTTCCGAGGGGGAAGTGCCGGGGAATAATTAATGTTTTTATTAAATTTGGAGGGAAATTTTTTGCAGCCGATCGCC
GCGCGTGGCCTTCAGGCTGATTGGAGTCCAGATCCCGAGGAAATCTCCAGATCCAATGCCCACTAAATAAAACACTGAG
CTCAGACTCGTGGAAGAGCCACAGGATGGATGGATTTTATGACCAGCAAGTGCCTTACATGGTCACCAATAATCCGCGT
GGGAGAAACTGTAATGAGAGACCGACAAATGTCAGGAAAAGAAAATTCATTAACAGAGACCTGGCTCATGATTCAGAAG
AACTCTTTCAAGATCTGAGCCAATTACAGGAGACATGGCTTGCAGAAGCTCAGGTACCTGACAATGACGAGCAGTTTGT
GCCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGTCTCCCTGTGAAAATCAAGAAGGAACCCCATAGCCCATGTTCA
GAACTTGGCTCTGCTTGTAGTCAAGAGCAACCATTCAAGTTCAGTTATGGGGAAAAGTGCCTGTACAATGTCAGTGCCT
ATGATCAGAAGCCACAAGTGGGAATGAGGCCCTCCAACCCACCAACGCCATCCAGCACTCCTGTGTCACCACTGCACCA
TGCCTCCCCAAACTCAGCTCAGACTCCTAAACCTGACCGGGTTTTCCCTGCCCATCTCCCTCCATCCCAATCCATTCAA
GACAACAGCTTCCCTATGGACCACAGATTTCGCCGCCAGCTCTCTGAACCTTGCAATTCTTTTCCACCTTTGCCTGCAA
TGCCGAGGGAAGGACGTCCAATATATCAGCGGCAGATGTCTGAGCCTAACATCCCCTTCCCGCCTCAAGGTTTTAAGCA
GGAGTATCACGATCCAGTTTATGAACACAACGCCATGGTTGGCAGTGCAGCCAGTCAAAATTTCCCCCCTCCTCTGATG
ATTAAACAGGAACCTAGAGATTTTGCATATGATTCAGAAGTGCCTAGCTGCCATTCCATTTACATGAGGCAAGAAGGCT
TCCTGGCTCACCCAAACAGAACAGAAGGTTGTATGTATGAAAAGGGACCTAGGCAGTTTTATGATGACACTTGTGTTGT
TCCAGAGAAGTTTGACGGTGATGTCAAACAGGAACCAGGCATGTACCGTGAGGGACCCACATATCAACGGCGAGGCTCA
CTTCAGCTGTGGCAGTTCTTGGTAGCTCTTCTCGATGACCCATCAAACTCCCACTTCATAGCATGGACTGGCCGAGGCA
TGGAATTCAAGCTGATTGAGCCGGAGGAGGTGGCACGTCGCTGGGGGATTCAGAAAAATAGGCCAGCTATGAACTATGA
TAAACTTAGCCGATCACTTCGCTATTATTATGAAAAGGGAATCATGCAAAAGGTTGCTGGAGAAAGATACGTCTACAAG
TTCGTTTGTGACCCTGAAGCGCTTTTCTCCATGGCCTTTCCAGACAACCAGCGCCCCTTACTGAAGACTGACATGGAGC
GCCACATCAATGAGGAGGACACTGTTCCCCTGTCCCACTTTGACGAGAGCATGGTCTACATGCAGGATAGTGGCTGCTG
CAACACCCACCCATATAATGAAGGCTACGTCTATTAACAACAGTGACAGTAAAGGGGGTGTTTTCCCCTCTCTTANGCT
TCTCCTCTTTCACAAAGAANCCAGAAGAAAGCTGAATCGACTTCAGTTTGTTTTTTAAATAGTACACTAAAAGGGGCTT
TTCCTGTTGCATTATTCCTATGGTCTGCCATGGACAGCGCACTTTATTTGAAAGGGGAGGGTTGGAAACTAAACATTAT
TGTGTGTAACAGGAGGAAAAGGGTGGGTTTGCTTTTTATTAAGTTTGGGAAGGGAACATACAGGTTTTAAGTACAAAAA
AGCTATATCATGTCTGTTTTGTTTCATATCAACATAAGATATTGTACATTTTCTCTGGGTATCCGTAGTACAGTTAATT
CTCATTGTGCAAAATAACCACTTGCTGATAATATCAGCACAGCATGCCTAGGGCAGTTGTTTCTTGCCATTCTTAATTG
TCTTTCTGCAGATATAAAAGAGAAGCAAAGCGTATACTGCAGCATTTAATTTAGAAATTTGAAGTGGTGGACCTTGCAG
CTTGCCTCCGAAAGCAAACAAATATCTCTAGAGTTTTACTTTGTTTGTTTGTTTGTTTGAAGGGCCTCAAAAAATAAAA
TCCCACTTATTTACAGAGTAGTCTTAAGAACAAGGACTAAGTCACAAAATCCCTGACTTCAGACTGCAAGCTGCATGCT
GTAACTGTTGCTATACATATATGGCCAGTGCTATCACTTGGACATTCCAAGATCCATNTGAGAGTAGTAATTACATGTG
ATAGGCTGTCTGATGATCATGTCAGCATTAAATACGGGATCATGATCAGGACGGAGAAAACTTTCGTATCCTTCCTTTC
CTTTGGTACATAAATAAGTTATTTAATCAATAGGAATTAACTGTACTAAGTCACATATCTAATTATGCTGTTTAGACAC
AGCAAGCACTCCTTGAGAAAAATATCCAATACACTAAATAGGTACTTTAGTAATTTTTAGACATGGTACCCATTAATAT
GCATTTAAACCTTTTACTGCTGTGTTATGTTGATAACATATATAAATACTAGATAATGCTAATGCTTCTGCTGCTGTCT
TTGTCTGTAATATTCTCTTTGATGCTGAATTTACTATGACCATTTATAAGCAATGCTGTAACTACAGGTAGCATTTCAG
GACAAAATAGATGACTTGAACCATTTATTGCTTAGAAAATAGCTTACGCCATAGCTGTGCTATAAGCAGCTTTTATGCG
CATCCACAAATGACTAGTAAGCTTCAGCTTGCTGAGGAAAGCTCTGCAGAACCTTTTGTGATATTCGGTGGAACAGAGA
GTAGACGAACTGTCAATACCATGAAGTCGCTGTATGACATTGTAGTGCTGGCACTGATGTTACCAATCAACTTGTTTTG
GACACTAAATGTAAATGTGATCAGAAAAAAAAAAAAAAAAAAAAAA
CommentsImages provided by Claire Anderson.Probe sequence was obtained from NCBI Accession: NM_204917.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Dermomyotome
Ear/Otic Placode
Ectoderm
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Pharyngeal Arches and Clefts
Pharynx
Somites
extraembryonic ectoderm
section 1
section 2

Entry 3

GEISHA IdER81.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CTGCTTCCGAGGGGGAAGTGCCGGGGAATAATTAATGTTTTTATTAAATTTGGAGGGAAATTTTTTGCAGCCGATCGCC
GCGCGTGGCCTTCAGGCTGATTGGAGTCCAGATCCCGAGGAAATCTCCAGATCCAATGCCCACTAAATAAAACACTGAG
CTCAGACTCGTGGAAGAGCCACAGGATGGATGGATTTTATGACCAGCAAGTGCCTTACATGGTCACCAATAATCCGCGT
GGGAGAAACTGTAATGAGAGACCGACAAATGTCAGGAAAAGAAAATTCATTAACAGAGACCTGGCTCATGATTCAGAAG
AACTCTTTCAAGATCTGAGCCAATTACAGGAGACATGGCTTGCAGAAGCTCAGGTACCTGACAATGACGAGCAGTTTGT
GCCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGTCTCCCTGTGAAAATCAAGAAGGAACCCCATAGCCCATGTTCA
GAACTTGGCTCTGCTTGTAGTCAAGAGCAACCATTCAAGTTCAGTTATGGGGAAAAGTGCCTGTACAATGTCAGTGCCT
ATGATCAGAAGCCACAAGTGGGAATGAGGCCCTCCAACCCACCAACGCCATCCAGCACTCCTGTGTCACCACTGCACCA
TGCCTCCCCAAACTCAGCTCAGACTCCTAAACCTGACCGGGTTTTCCCTGCCCATCTCCCTCCATCCCAATCCATTCAA
GACAACAGCTTCCCTATGGACCACAGATTTCGCCGCCAGCTCTCTGAACCTTGCAATTCTTTTCCACCTTTGCCTGCAA
TGCCGAGGGAAGGACGTCCAATATATCAGCGGCAGATGTCTGAGCCTAACATCCCCTTCCCGCCTCAAGGTTTTAAGCA
GGAGTATCACGATCCAGTTTATGAACACAACGCCATGGTTGGCAGTGCAGCCAGTCAAAATTTCCCCCCTCCTCTGATG
ATTAAACAGGAACCTAGAGATTTTGCATATGATTCAGAAGTGCCTAGCTGCCATTCCATTTACATGAGGCAAGAAGGCT
TCCTGGCTCACCCAAACAGAACAGAAGGTTGTATGTATGAAAAGGGACCTAGGCAGTTTTATGATGACACTTGTGTTGT
TCCAGAGAAGTTTGACGGTGATGTCAAACAGGAACCAGGCATGTACCGTGAGGGACCCACATATCAACGGCGAGGCTCA
CTTCAGCTGTGGCAGTTCTTGGTAGCTCTTCTCGATGACCCATCAAACTCCCACTTCATAGCATGGACTGGCCGAGGCA
TGGAATTCAAGCTGATTGAGCCGGAGGAGGTGGCACGTCGCTGGGGGATTCAGAAAAATAGGCCAGCTATGAACTATGA
TAAACTTAGCCGATCACTTCGCTATTATTATGAAAAGGGAATCATGCAAAAGGTTGCTGGAGAAAGATACGTCTACAAG
TTCGTTTGTGACCCTGAAGCGCTTTTCTCCATGGCCTTTCCAGACAACCAGCGCCCCTTACTGAAGACTGACATGGAGC
GCCACATCAATGAGGAGGACACTGTTCCCCTGTCCCACTTTGACGAGAGCATGGTCTACATGCAGGATAGTGGCTGCTG
CAACACCCACCCATATAATGAAGGCTACGTCTATTAACAACAGTGACAGTAAAGGGGGTGTTTTCCCCTCTCTTANGCT
TCTCCTCTTTCACAAAGAANCCAGAAGAAAGCTGAATCGACTTCAGTTTGTTTTTTAAATAGTACACTAAAAGGGGCTT
TTCCTGTTGCATTATTCCTATGGTCTGCCATGGACAGCGCACTTTATTTGAAAGGGGAGGGTTGGAAACTAAACATTAT
TGTGTGTAACAGGAGGAAAAGGGTGGGTTTGCTTTTTATTAAGTTTGGGAAGGGAACATACAGGTTTTAAGTACAAAAA
AGCTATATCATGTCTGTTTTGTTTCATATCAACATAAGATATTGTACATTTTCTCTGGGTATCCGTAGTACAGTTAATT
CTCATTGTGCAAAATAACCACTTGCTGATAATATCAGCACAGCATGCCTAGGGCAGTTGTTTCTTGCCATTCTTAATTG
TCTTTCTGCAGATATAAAAGAGAAGCAAAGCGTATACTGCAGCATTTAATTTAGAAATTTGAAGTGGTGGACCTTGCAG
CTTGCCTCCGAAAGCAAACAAATATCTCTAGAGTTTTACTTTGTTTGTTTGTTTGTTTGAAGGGCCTCAAAAAATAAAA
TCCCACTTATTTACAGAGTAGTCTTAAGAACAAGGACTAAGTCACAAAATCCCTGACTTCAGACTGCAAGCTGCATGCT
GTAACTGTTGCTATACATATATGGCCAGTGCTATCACTTGGACATTCCAAGATCCATNTGAGAGTAGTAATTACATGTG
ATAGGCTGTCTGATGATCATGTCAGCATTAAATACGGGATCATGATCAGGACGGAGAAAACTTTCGTATCCTTCCTTTC
CTTTGGTACATAAATAAGTTATTTAATCAATAGGAATTAACTGTACTAAGTCACATATCTAATTATGCTGTTTAGACAC
AGCAAGCACTCCTTGAGAAAAATATCCAATACACTAAATAGGTACTTTAGTAATTTTTAGACATGGTACCCATTAATAT
GCATTTAAACCTTTTACTGCTGTGTTATGTTGATAACATATATAAATACTAGATAATGCTAATGCTTCTGCTGCTGTCT
TTGTCTGTAATATTCTCTTTGATGCTGAATTTACTATGACCATTTATAAGCAATGCTGTAACTACAGGTAGCATTTCAG
GACAAAATAGATGACTTGAACCATTTATTGCTTAGAAAATAGCTTACGCCATAGCTGTGCTATAAGCAGCTTTTATGCG
CATCCACAAATGACTAGTAAGCTTCAGCTTGCTGAGGAAAGCTCTGCAGAACCTTTTGTGATATTCGGTGGAACAGAGA
GTAGACGAACTGTCAATACCATGAAGTCGCTGTATGACATTGTAGTGCTGGCACTGATGTTACCAATCAACTTGTTTTG
GACACTAAATGTAAATGTGATCAGAAAAAAAAAAAAAAAAAAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204917.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2999

Mouse

EmageMGI:99254
EurexpressMGI:99254
MGI GXDMGI:99254

Frog

Xenbase489878

Fruit Fly

BDGP

Zebra Finch

ZEBrAETV1

Zebrafish

ZFINZDB-GENE-070104-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona