GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

FOXO1
forkhead box O1

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolFOXO1
Official Full Nameforkhead box O1
CGNC ID49093
also known asFOXO1A, forkhead box protein O1|forkhead box O1A
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204328
PolypeptideNP_989659
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3406
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2308ENSG00000150907MIM:268220MIM:136533
Mouse56458ENSMUSG00000044167All phenotypic alleles (11):Targeted, knock-out(4) Targeted, other(7) MGI:1890077
Xenopus493378, 444991482527
Zebrafish567969, 768121ENSDARG00000061549, ENSDARG00000063540ZDB-GENE-080425-3, ZDB-GENE-061013-59ZFIN:ZDB-GENE-080425-3, ZFIN:ZDB-GENE-061013-59
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene374231
Ensembl Gene
KEGGgga:374231

Entry 1

GEISHA IdFOXO1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-AACCCAGTCGTCATCTGCTG-3’
Reverse cDNA Template Primer5’-ATTAACCCTCACTAAAGGTCCATGTCACAGTCCAACCG-3’cDNA Template Length681
Complete cDNA Template Probeshow
AACCCAGTCGTCATCTGCTGCCCTGATGCAGCAAACACCAGGTTACTCATTTGCATCTTCAACAACAAGTATATGTTCA
CCAAATCCAGACTACAGGAAATTTACGTATGCTCAAGCTAGCATGAACTCTTTGCCCCAAATTCCTATGCAGACTCTCC
AAGACAGTAAATCAAGCTATGGATCGATGAGCCAATTTAACTGTCCTGCAGGACTTTTGAAGGAGTTACTGACTTCTGA
TTCTCCTCCGCATAATGATATCTTGGCATCAGTAGACACTGGTGTTTCCCAGGCTGGTGGCAGGGCGCTGGGCCAAGGT
GTACTGATGGTCACTAATTCAGTGATGCCAACTTATGGCAATCAGCCACCTCACAACAAAATGATGAACCCTAACGCCC
GTCCTCACCAAGGACATAACCAGCCAACACCTGCAGTTAATGGCCGTGCCTTGTCACACACAGTGAACCCCATGTCACA
TACTTCATGTCTAAATCGCTTGTCGACAGTGAAGACTTCATTACAAGTGCCTATGAGTCACCAGATGCAGATGAATGCT
ATGAACCCGTATGCCCCTGTTAACAGTTGCAACGGCTACGGAAGGGTGGGAATTGTTTCCCTCCACCAGGAGAAGCTTC
CCAGTGACTTAGATGACATGTTAATTGAACGGTTGGACTGTGACATGGA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Unlabeled
 
13-18
stage 16
Widespread Expression
 
19-24
stage 20
stage 21
Atria
Foregut
Head Mesenchyme
Leg Mesenchyme
Liver
Lung
Mesonephros
Myotome
Neural Plate/Tube
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Sinus Venosus
Spinal Ganglia and Nerves
Ventricles
Widespread Expression
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
Atria
Foregut
Lung
Mesonephros
Myotome
Outflow Tract
Sclerotome
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Widespread Expression
 

Entry 2

GEISHA IdFOXO1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
CTGGACAACAGTTTTTGTGCTGGCAGAAGAAAGAGAGAAAAACGTATTTTCACTGATTATTGTTTTGTCTACGACGCTC
ACAATTGGAAAATGTTCTAATTGAAACTCTGCTTCCCTGTAGTGATGCTGTATGGTGGAGAAAGAAATGGGATGTGCCA
AGAAAATGAGGTTCAGTAATAAGCCATATATTTAATTATCCTGTTATGACTTTCCTAAGACTCTGCAATGCATCCACTG
ATGTGCTAGCATTTAGCACCCTGTTGGGCTTAAATCACTACTAACTACAGCTACTTTTTAGATATCTAATTACAGTTGT
CAGCAGTTCCAGGGGTTGACGTTAAGCTGTCCTGTGATATGGGATCTCCCCCAGTGTGATAGTGGTCTTTGAACTGTTG
AGCATTAAATGTTTGTGGTGCTGAAGCCTCAGCAAAACAGCCTGCTTTTACGGCCAAAAACTTCAACTAGCATCATCAC
CATCAACTTCACAGTCTCTGAGAGTTGATAGTAAACCCTGGCAATGGGCTTACACACAAGTTTCTGAGGATCTTTCTTT
CTGCTGCATGTGCAAAAACGTTTGTTTCCAAATGGGGATTGATAGTGCAGTCCAAGCTAGGCACAAAATCCACCTCTGT
GCACAAGGAAAGCAGTACTTAACTGTAAGCTCCATGGGGTTGCAGCTAAACATGCTACATTTAACAATATACCTCCTGT
TTATTATTTACTGCTACTGTACAAACTCCTAGATACAGGTATTTTCTTCCTTTCCTTTTATAACTATGAATATCATAAA
TGTAGCTGTCCCCGAGTTACAACCCTCTGTAGGAAGCCCCTTTTAATTACTGAGAGAAAACAGTTGTAGATAATCAGAG
GTTTTGGGTCATGCGGTCGAATTTACTNTCTTTTGCATGGTGCCATTCAAATATTTTGCAATTGTAATTCTGGAATACT
GTGAAGTCTGATGANGGGCATGTTGNCTGCCTTTGAAAGCAAACATTTNGCNAACCCCNGGGTAATAAATCCCTTTTTC
AGTAAAAANGTACCCGAGTTTNCTGGNAGTAANCTTAAGTTTGGTCNNAAATTGTTTGNAAANTGANTTGGGTTNGGTG
AAATTGTGGCCGGATGA
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST232b16.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Widespread Expression
 

Entry 3

GEISHA IdFOXO1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CATTGGACAAACAGTTTTGTGCTGGCAGAAGAAAGAGAGAAAAACGTATTTTCACTGATTATGTTTGTCTACGACGCTC
ACAATGGAAAATGTCTAATGAAACTCTGCTTCCCTGTAGTGATGCTGTATGGTGGAGAAAGAAATGGGATGTGCCAAGA
AAATGAGGTTCAGTAATAAGCCATATATTTAATTATCCTGTTATGACTTTCCTAAGACTCTGCAATGCATCCACTGATG
TGCTAGCATTTAGCACCCTGTTGGGCTTAAATCACTACTAACTACAGCTACTTTTTAGATATCTAATTACAGTTGTCAG
CAGTTCCAGGGGTTGACGTTAAGCTGTCCTGTGATATGGGATCTCCCCCAGTGTGATAGTGGTCTTTGAACTGTTGAGC
ATTAAATGTTTGTGGTGCTGAAGCCTCAGCAAAACAGCCTGCTTTTACGGCCAAAAACTTCAACTAGCATCATCACCAT
CAACTTCACAGTCTCTGAGAGTTGATAGTAAACCCTGGCAATGGGCTTACACACAAGTTTCTGAGGATCTTTCTTTCTG
CTGCATGTGCAAAAACGTTGTTTCCAAATGGGGATTGATAGTGCAGTCCAAGCTAGGCACAAAATCCACCTCTGTGCAC
AAGGAAAGCAGTACTTAACTGTAAGCTCCATGGGGGTTGCAGCTAAACATGCTACATTTAACAATATACCTCCTGTTTA
TTATTTACTGCTACTGTACAAACTCCTAGATACAGGTATTTTCTTCCCTTTTCCTTTTATAACTATGAATATCATCAAT
GTTAGCTGTCCCCCGAGTTACAACCCTCTGTAAGGAAGCCCCTTTTAATTACTGAGAGAAAACAGGTTGTCGATCACTC
AGAGGGTTGGGGTCAATGCGGGCGAATTACTTTCTTTTGCTGGTGCCATCCAATATTTGCACTTGTATTCCGGAATACG
TGGAGCTGATGAGGGCTGGTTGTTGCCTGAAAAGCAATTATGGAC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3406

Mouse

EmageMGI:1890077
EurexpressMGI:1890077
MGI GXDMGI:1890077

Frog

Xenbase482527

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-080425-3, ZDB-GENE-061013-59
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona