Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
RACK1 Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol RACK1 Official Full Name receptor for activated C kinase 1 CGNC ID 61 also known as C12-3, GNB2L1, c12.3, receptor of activated protein C kinase 1|Guanine nucleotide-binding protein beta subunit2-like 1|MHC B complex protein 12.3|guanine nucleotide binding 12.3|guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1|guanine nucleotide-binding protein beta subunit 2-like 1|guanine nucleotide-binding protein subunit beta-2-like 1|guanine nucleotide-binding protein subunit beta-like protein 12.3|receptor of activated protein kinase C 1, Guanine nucleotide-binding protein subunit beta 2-like 1, Guanine nucleotide-binding protein subunit beta-like protein 12.3, Receptor of activated protein kinase C 1 (RACK1), RACK1, Receptor for activated C kinase gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function cysteine-type endopeptidase activator activity involved in apoptotic process , more... ion channel inhibitor activity , protein kinase C binding , protein phosphatase binding , protein tyrosine kinase inhibitor activity , receptor tyrosine kinase binding , SH2 domain binding Biological Process negative regulation of cell growth , negative regulation of phagocytosis , more... negative regulation of protein kinase B signaling , negative regulation of Wnt signaling pathway , positive regulation of apoptotic process , positive regulation of cAMP catabolic process , positive regulation of cell migration , positive regulation of cyclic-nucleotide phosphodiesterase activity , positive regulation of gastrulation , positive regulation of GTPase activity , positive regulation of intrinsic apoptotic signaling pathway , positive regulation of proteasomal ubiquitin-dependent protein catabolic process , positive regulation of protein homooligomerization , positive regulation of protein phosphorylation , regulation of cell cycle , regulation of cell division , regulation of establishment of cell polarity , regulation of protein localization , signal transduction Cellular Component cytoplasm , dendrite , midbody , neuronal cell body , nucleus , perinuclear region of cytoplasm , phagocytic cup
Links to other databases
GEISHA Id GBLP.21B2 Data Source GEISHA ISH Analysis Forward cDNA Template Probe show TGGGACCTCACCACACGAACCACCACCCGCCGCTTTGTTGGCCACACCAAGGATGTGCTGAGCGTTGCCTTCTCCTCCG
Comments Widespread expression detected at stages 4, 11, 16, 19, 24, 25.
no images
Data from NCBI Unigene EST ProfileGga.7066
Mouse Frog Fruit Fly Zebra Finch Zebrafish
