GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GBX2
gastrulation brain homeobox 2

Gene
Official SymbolGBX2
Official Full Namegastrulation brain homeobox 2
CGNC ID10048
also known ashomeobox protein GBX-2|gastrulation and brain-specific homeobox protein 2|gastrulation brain homeo box 2|gastrulation brain homeobox 2 protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205068
PolypeptideNP_990399
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.565
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2637ENSG00000168505MIM:601135
Mouse14472All phenotypic alleles (9):Targeted, knock-out(1) Targeted, other(8) MGI:95668
Xenopus100485559, 399181855770
Zebrafish245948ENSDARG00000002933ZDB-GENE-020509-2ZFIN:ZDB-GENE-020509-2
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processtranscription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene395950
Ensembl Gene
KEGGgga:395950

Entry 1

GEISHA IdGBX2.Vieira.2005Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationVieira C, Garda AL, Shimamura K, Martinez S. Thalamic development induced by Shh in the chick embryo. Dev Biol. 2005 Aug 15;284(2):351-63.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205068).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
stage 23
Central Nervous System
Thalamus

Entry 2

GEISHA IdGBX2.Bok.2005Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationBok J, Bronner-Fraser M, Wu DK. Role of the hindbrain in dorsoventral but not anteroposterior axial specification of the inner ear. Development. 2005 May;132(9):2115-24. Epub 2005 Mar 23.
CopyrightCopyright for articles in Development are retained by the authors. Permission granted by MBF.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205068).
no images

Entry 3

GEISHA IdGBX2.Garcia-Lopez.2009Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationGarcía-López R, Soula C, Martínez S. Expression analysis of Sulf1 in the chick forebrain at early and late stages of development. Dev Dyn. 2009 Sep;238(9):2418-29.
CopyrightCopyright © 2009 John Wiley & Sons, Inc. All Rights Reserved.
Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205068.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-40
stage 40
Diencephalon
double label

Entry 4

GEISHA IdGBX2.Sanchez-Calderon.2004Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationSánchez-Calderón H, Martín-Partido G, Hidalgo-Sánchez M. Otx2, Gbx2, and Fgf8 expression patterns in the chick developing inner ear and their possible roles in otic specification and early innervation. Gene Expr Patterns. 2004 Oct;4(6):659-69.
CopyrightReprinted with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205068).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placode
double labeled
25-30
stage 27
stage 27
stage 27
Ear/Otic Placode
double labeled
31-34
stage 34
stage 34
stage 34
Ear/Otic Placode
double labeled

Entry 5

GEISHA IdGBX2.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
GGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAGGCGGGCAACGCCAGCTCCAAGGCG
GGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCCGCTTCGCCATCAGGAGTCAGCACC
AGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACAACCGGGGTTTTCGCCGGACCCGCT
CTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAGCGAACGACCCAAACGAACGCCTCC
CCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGCGATACGGCGGAGCCCCACGCCGGC
AGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGGACCGCATCGCCCCGCAGCGCTACG
GGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGTTGAGAGGAGAGGGGGAGAGAGAGA
GAGAGGAGGGGAGGGGGGGGAGGAGGACGGACGGACGGACAGACGGACACCGAGGAAAGCACGAATTCAGCGTTGTGGT
TTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAATTTAAGGAGCCAACTCCCGTCTGTGAAT
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsThe cDNA template used to generate the probe was obtained by PCR as described 5-ggtgcaggtgaagatctggt-3’; 5-attcacaagacgggagttgg −3’
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
Early Mesoderm
Epiblast
Head Process
Primitive Streak
 
7-11
stage 7
stage 7
stage 9
stage 11
Ear/Otic Placode
Early Mesoderm
Heart Tube
Hindbrain
Isthmus/MHB
Midbrain
Neural Plate/Tube
Splanchnic Mesoderm
 

Entry 6

GEISHA IdGBX2.Merchan.2011Data SourcePublication
Complete cDNA Template Probeshow
AGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTGG
AGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGTT
CACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGATC
GCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAGG
CGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCCG
CTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACAA
CCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAGC
GAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGCG
ATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGGA
CCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGTT
GAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGACG
GACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAATT
TAAGGAGCCAACTCCCGTCTTGTGAAT
CitationMerchán,P, Bardet, SM, Puelles, L, Ferran, JL, Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos. Front Neuroanat. 2011; 5: 23. Prepublished online 2010 December 29. Published online 2011 April 5
CopyrightCopyright © 2011 Merchán, Bardet, Puelles and Ferran.
CommentsThe probe was amplified by PCR using the following primers: 5′-AGCGACCTCGACTACAGCTC-3' and 5′-ATTCACAAGACGGGAGTTGG-3′and was extracted form NCBI acc. # NM_205068.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-27
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 27
stage 27
stage 27
stage 27
Diencephalon
Mesencephalon
Unlabeled Embryonic
PcP precommissural pretectum, JcP juxtacommissural pretectum, CoP commissural pretectum, Th Thalamus , mes mesencephalon, Hab habenular region
PcP precommissural pretectum, JcP juxtacommissural pretectum, CoP commissural pretectum, Th Thalamus, mes mesencephalon, Hab habenular region
Quail

Entry 7

GEISHA IdGBX2.Tossell.2011Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationTossell K, Kiecker C, Wizenmann A, Lang E, Irving C. Notch signalling stabilises boundary formation at the midbrain-hindbrain organiser. Development. 2011 Sep;138(17):3745-57. Epub 2011 Jul 27.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205068).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 9
stage 9
stage 9
stage 9
stage 9
stage 10
stage 10
Isthmus/MHB
Rhombomeres
24 hours after electroporation
double in situ: OTX2(red) and GBX2(blue)
double in situ: Otx2 (red) and Gbx2 (blue)

Entry 8

GEISHA IdGBX2.Tossell.2011BData SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationTossell K, Andreae LC, Cudmore C, Lang E, Muthukrishnan U, Lumsden A, Gilthorpe JD, Irving C. Lrrn1 is required for formation of the midbrain-hindbrain boundary and organiser through regulation of affinity differences between midbrain and hindbrain cells in chick. Dev Biol. 2011 Apr 15;352(2):341-52.
CopyrightCopyright © 2011 Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205068).
no images

Entry 9

GEISHA IdGBX2.Larsen.2001Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationLarsen CW, Zeltser LM, Lumsden A. Boundary formation and compartition in the avian diencephalon. J Neurosci. 2001 Jul 1;21(13):4699-711.
CopyrightCopyright © 2012 by the Society for Neuroscience
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205068.1).
no images

Entry 10

GEISHA IdGBX2.Sánchez-Guardado.2009Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationSánchez-Guardado LO, Ferran JL, Mijares J, Puelles L, Rodríguez-Gallardo L, Hidalgo-Sánchez M. Raldh3 gene expression pattern in the developing chicken inner ear. J Comp Neurol. 2009 May 1;514(1):49-65. doi: 10.1002/cne.21984.
CopyrightCopyright © 1999–2013 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_205068.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
Ear/Otic Placode
 

Entry 11

GEISHA IdGbx2.Jungbluth.2001Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationStefan Jungbluth, Chris Phelps, Andrew Lumsden. CEPU-1 expression in the early embryonic chick brain. Mech Dev. 2001 Mar;101(1-2):195-7.
CopyrightCopyright © 2001 Elsevier Science Ireland Ltd.
CommentsAuthors indicated that Gbx2 probe was a gift of A. Leutz. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession NM_205068.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
Isthmus/MHB
double in situ: Gbx2 in red, CEPU-1 in blue.
all
 
  

Entry 12

GEISHA IdGbx2.Hidalgo-Sánchez.1999Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationHidalgo-Sánchez M, Millet S, Simeone A, Alvarado-Mallart RM. Comparative analysis of Otx2, Gbx2, Pax2, Fgf8 and Wnt1 gene expressions during the formation of the chick midbrain/hindbrain domain. Mech Dev 1999 Mar;81(1-2):175-8.
CopyrightCopyright © 1999 Elsevier Science Ireland Ltd.
CommentsAuthors indicated the probe was synthesized from the full-length chicken GBX2 cDNA. Above sequence is obtained from NCBI Accession number NM_205068.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 10
Isthmus/MHB
Mesencephalon
Rhombomeres
Double ISH, Gbx-2 in purple.
19-20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
Isthmus/MHB
Rhombomeres
Double ISH, Gbx-2 in purple.
Double ISH, Gbx-2 in purple.

Entry 13

GEISHA IdGBX2.Freter.2012Data SourcePublication
Complete cDNA Template Probeshow
GAATTCCGGGGAGGAGGAAGAAGGTGGTCGCCGCTGCTCCTCCGCCGGCCCGGCATGAGCGCGGCTTTCCAGCCCTCGC
TGATGATGATGCAGCGCCCGCTGGGAAGCAGCACGGCCTTCAGCATCGATTCGCTCATCGGCAGCCCCCCGCCGCCCGC
CCCCGGCCACTTCGTCTACACCGGCTACCCCATGTTCATGCCGTACCGGCCCGTCGTGCTGCCCCCCCCGCCGCCCGCC
CTGCCGCAGGCCGCCCTGCAGCCGCCGCTGCCCCCCGCGCCGCCCCCGCCGCTGCCCGCGTTGCCCGGAGCCTTCTGCC
CCGGGCTGGCGCAGGGCATGGCCCTCACCTCCACGCTGATGGCCGCGCTGCCCGGCTCCTTCCCCGCCTCCCCGCCGCG
CCCCGAGGCCGCCAGGAAGTTCGCCCCCCCGGGGAACTTCGACAAGGCCGACGGACTGCCTCCCCCGGACGGCGGCGGC
GGCGGCGGAGACGACGGCAAAACCGGGGGGGGGCTGCTACCCTTCCCCGCTGCCGACGCCGTGCACGCATCGCTGGCCG
GGGCCCTCCGCGGCGGCCCCAAAGACGATCCCAAAGCGGAGGAGGAGGCGAAGGGCCGCGAGGAGAACTTCTCCATGGA
CAGCGACCTCGACTACAGCTCCGACGAGAACGGCCCCGCGCCGGCGGCCCCGCGGGAGGAGGACTGTGGCACCGCGTTG
GAGGAGAACCCCCCCAGCGCCGCCAACGCCGCCGCCAACGCCGCGGCCACGGGGAAGAACCGACGGCGGCGGACGGCGT
TCACCAGCGAGCAGCTGCTGGAGCTGGAGAAGGAGTTCCACTGCAAGAAGTACCTCTCGCTGACGGAGCGCTCGCAGAT
CGCGCACGCCCTGAAGCTGAGCGAGGTGCAGGTGAAGATCTGGTTCCAGAACAGGCGAGCCAAATGGAAGCGGGTGAAG
GCGGGCAACGCCAGCTCCAAGGCGGGGGAACCGTCGCGGAACCCCAAGATCGTCGTGCCCATCCCCGTGCACGTCAGCC
GCTTCGCCATCAGGAGTCAGCACCAGCAGCTGGAGCAGGCGCGGCCCTGAGCGCCGCTGGGGGGGCAAAAAAGTTGACA
ACCGGGGTTTTCGCCGGACCCGCTCTGAAAAGCGAAACGAGCGACGGAAACCAACCCAAACAGACGAAAACGACCCAAG
CGAACGACCCAAACGAACGCCTCCCCGCCCCCCCAAAATGAACCTAGAAGCGACGCGACTCCACCGGCGACCCACGAGC
GATACGGCGGAGCCCCACGCCGGCAGCGAGCGGCAGAACTGAAGGCGGAACGCCGCGCGGAGCGGGGCCGGGGACCGGG
ACCGCATCGCCCCGCAGCGCCACGGGGTAACGGCGCTGGGGGAGCCGTCGGTGCGGGGCCGCCCCTCGCAGAGCCGCGT
TGAGAGGAGAGGGGGAGAGAGAGAGAGAGAGGAGGGGAGGGGGGGGGGGGGAGGAGGACGGACGGACGGACGGACAGAC
GGACACCGAGGAAAGCACGAATTCAGCGTTGTGGTTTAATTTATTTCGATGTAGCCCGTTTCCTTCTAAGTTATGAAAT
TTAAGGAGCCAACTCCCGTCTTGTGAATAAAAGCCGACAAAGAAACCCGGAATTC
CitationFreter S, Muta Y, O'Neill P, Vassilev VS, Kuraku S, Ladher RK. Pax2 modulates proliferation during specification of the otic and epibranchial placodes. Dev Dyn. 2012 Nov;241(11):1716-28
CopyrightCopyright © 2012 Wiley Periodicals, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_205068.1). GBX2 is also known as: GBX1 in NCBI.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-14
stage 14
stage 14
stage 14
Central Nervous System
Ear/Otic Placode
Placode
control = left side of embryo
cross section of figure 4M.
stage 13/14, 16 to 22 somites
all
 
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.565

Mouse

EmageMGI:95668
EurexpressMGI:95668
MGI GXDMGI:95668

Frog

Xenbase855770

Fruit Fly

BDGP

Zebra Finch

ZEBrAGBX2

Zebrafish

ZFINZDB-GENE-020509-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona