GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GDF3
growth differentiation factor 3

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolGDF3
Official Full Namegrowth differentiation factor 3
CGNC ID49666
also known asCVG1, GDF1, embryonic growth/differentiation factor 1|growth differentiation factor 1|growth factor CVg1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205211
PolypeptideNP_990542
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4324
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human9573ENSG00000184344MIM:613702MIM:606522
Mouse14562ENSMUSG00000030117All phenotypic alleles (6):Targeted, knock-out(1) Targeted, other(3) Gene trapped(2) MGI:95686
Xenopus493288, 394305487308
Zebrafish30125ENSDARG00000037995ZDB-GENE-980526-389ZFIN:ZDB-GENE-980526-389
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396132
Ensembl GeneENSGALG00000003161
KEGGgga:396132

Entry 1

GEISHA IdGDF3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATGCTCCCATCAGGCAATCATCAC
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGGAGAGAGGTATCCAGGAAAGAGTCGcDNA Template Length829
Forward cDNA Template Probeshow
GCTGGGAGTGGGTCCCCTGCACAGCACTGCTCTTTGTCTGTGGGTAGGAAAGCAGAGCATGTGGTGGCCTCTCCCTGCG
TGTGCCAGCTTTGGAGCTGGCCTTGCCTGGGCTCTCCTTACTGTGGCTCTGGGGATGGATTTAAGTTTGCAGGAAAGTT
TGCTGTTAAAATCCCTGGGTCTGAGCGCAAAGCCCAGCCCCAAAATCCCCATCCCGGTGCCATCTGTGCTCTGGAGGAT
CTTCCAGAAGAGAAGGAGCCCTCCTGCAACAAACAGAGACCCGGTGGATGGTTGTAGGGTGGAGGAGTTTAATGTCCCT
GGGAACATCATCCGTGTCTTCGCTGACCAAGG
Reverse cDNA Template Probeshow
AGGCTGCTTCATTCATAGCACGCAGCCCCATCCGCTGCTGTGTCTGCAGAAGCGTCTGTACTTTAACCTCTCTGTGCTG
GAGGAGGATGAGCGCCTGACCATGGCTCAGCTGGAGATCAAATTCAGCCACAATTCGTACCACAGCCCCGGCCGGGGGG
GGGACTTCGAGCTGAGGCTGTACCGCAGCTGCCCGGTGCCGCTGAGGGGGACGCCCTCCCTGGAGCGAGGCCGCAAGCT
GCTGCTGGAGCAGTCCTTTGCCCGCCTGCACAAGTCTCTGCTCTTCAACCTGAGCGACGTGGCAAAGGACTGGACAACT
CACAGCAGGAACCTGGGCTTGATTCTGGAGATCGCGGTGAGCGGAGACGGAGCCTCAGCCCCGGGGAGCACGGGGCCAC
AGAGCCCCTGTGCCGGCAT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 6
Early Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Primitive Streak
 
7-12
stage 7
stage 8
stage 8
stage 12
stage 12
Anterior Intestinal Portal
Area Opaca
Forebrain
Heart
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Paraxial Mesoderm
Somites
Dorsal view.
Stage 8-
Ventral view.
13-18
stage 14
stage 17
Anterior/Second Heart Field
Forebrain
Heart
Heart Tube
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Oral Pharynx
Outflow Tract
Paraxial Mesoderm
Somites
Spinal Cord
 
19-24
stage 20
stage 20
stage 22
stage 22
stage 23
stage 23
Anterior/Second Heart Field
Atria
Forebrain
Gut
Heart
Hindbrain
Midbrain
Neural Plate/Tube
Oral Pharynx
Outflow Tract
Somites
Spinal Cord
Tail
 
25-26
stage 26
stage 26
Atria
Forebrain
Gut
Hindbrain
Midbrain
Neural Plate/Tube
Outflow Tract
Somites
Spinal Cord
 

Entry 2

GEISHA IdVg1.Joubin.1999Data SourcePublication
Complete cDNA Template Probeshow
CCACGGGGAGCTGTTCACACCCTCTGCCCAATCCTGGGAATCCCTGTGTGCTAATTGAGCACTAACGAGATCAAAGCTC
CCATCAGGCAATCATCACCCCCTGGCTCTGTCTTCAGTGCAGCTGGGAGTGGGTCCCCTGCACAGCACTGCTCTTTGTC
TGTGGGTAGGAAAGCAGAGCATGTGGTGGCCTCTCCCTGCGTGTGCCAGCTTTGGAGCTGGCCTTGCCTGGGCTCTCCT
TACTGTGGCTCTGGGGATGGATTTAAGTTTGCAGGAAAGTTTGCTGTTAAAATCCCTGGGTCTGAGCGCAAAGCCCAGC
CCCAAAATCCCCATCCCGGTGCCATCTGTGCTCTGGAGGATCTTCCAGAAGAGAAGGAGCCCTCCTGCAACAAACAGAG
ACCCGGTGGATGGTTGTAGGGTGGAGGAGTTTAATGTCCCTGGGAACATCATCCGTGTCTTCGCTGACCAAGGCTGCTT
CATTCATAGCACGCAGCCCCATCCGCTGCTGTGTCTGCAGAAGCGTCTGTACTTTAACCTCTCTGTGCTGGAGGAGGAT
GAGCGCCTGACCATGGCTCAGCTGGAGATCAAATTCAGCCACAATTCGTACCACAGCCCCGGCCGGGGGGGGGACTTCG
AGCTGAGGCTGTACCGCAGCTGCCCGGTGCCGCTGAGGGGGACGCCCTCCCTGGAGCGAGGCCGCAAGCTGCTGCTGGA
GCAGTCCTTTGCCCGCCTGCACAAGTCTCTGCTCTTCAACCTGAGCGACGTGGCAAAGGACTGGACAACTCACAGCAGG
AACCTGGGCTTGATTCTGGAGATCGCGGTGAGCGGAGACGGAGCCTCAGCCCCGGGGAGCACGGGGCCACAGAGCCCCT
GTGCCGGCATCGACTCTTTCCTGGATACCTCTCTCCTGGTGGTGACTCTCAGCCAGCAGCAGTGCGGGGCCTCCAGGAG
GAGGAGGAGTGCTTACAACGTCCCCGTCACACCGAGCAACCTCTGCAAGCCCCGACGCCTTTACATCAGCTTCAGTGAC
GTTGGCTGGGAGAATTGGATCATCGCCCCGCAGGGCTACATGGCCAACTACTGCCTGGGCGAGTGCCCCTTCCCCCTCA
CAGCTGAGCTCAACAGCACCAACCACGCCATCCTGCAGACCATGGTGCACTCACTGGACCCCGAGGGGACGCCCCAGCC
CTGCTGCGTCCCCGTCAGGCTGTCCCCCATCTCCATCCTCTACTATGACAACAGTGACAACGTGGTGCTGAGGCACTAC
GAGGACATGGTGGTGGATGAGTGTGGCTGCAGATAGCGGAGTGGATGTGGGTATGTGCTGTGGGGTCCCGTGTGGCACA
CGGAATGATGGATGGAATAAATCCAAGTGTGACA
CitationJoubin K, Stern CD. Molecular interactions continuously define the organizer during the cell movements of gastrulation. Cell. 1999 Sep 3;98(5):559-71.
CopyrightCopyright © 1999 Cell Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205211).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
Primitive Streak
 

Entry 3

GEISHA IdVG1.Shah.1997Data SourcePublication
Complete cDNA Template Probeshow
CTAGCGTGCCGCAGACCCCGGGGGCCACGGGGAGCTGTTCACACCCTCTGCCCAATCCTGGGAATCCCTGTGTGCTAAT
TGAGCACTAACGAGATCAAAGCTCCCATCAGGCAATCATCACCCCCTGGCTCTGTCTTCAGTGCAGCTGGGAGTGGGTC
CCCTGCACAGCACTGCTCTTTGTCTGTGGGTAGGAAAGCAGAGCATGTGGTGGCCTCTCCCTGCGTGTGCCAGCTTTGG
AGCTGGCCTTGCCTGGGCTCTCCTTACTGTGGCTCTGGGGATGGATTTAAGTTTGCAGGAAAGTTTGCTGTTAAAATCC
CTGGGTCTGAGCGCAAAGCCCAGCCCCAAAATCCCCATCCCGGTGCCATCTGTGCTCTGGAGGATCTTCCAGAAGAGAA
GGAGCCCTCCTGCAACAAACAGAGACCCGGTGGATGGTTGTAGGGTGGAGGAGTTTAATGTCCCTGGGAACATCATCCG
TGTCTTCGCTGACCAAGGCTGCTTCATTCATAGCACGCAGCCCCATCCGCTGCTGTGTCTGCAGAAGCGTCTGTACTTT
AACCTCTCTGTGCTGGAGGAGGATGAGCGCCTGACCATGGCTCAGCTGGAGATCAAATTCAGCCACAATTCGTACCACA
GCCCCGGCCGGGGGGGGGACTTCGAGCTGAGGCTGTACCGCAGCTGCCCGGTGCCGCTGAGGGGGACGCCCTCCCTGGA
GCGAGGCCGCAAGCTGCTGCTGGAGCAGTCCTTTGCCCGCCTGCACAAGTCTCTGCTCTTCAACCTGAGCGACGTGGCA
AAGGACTGGACAACTCACAGCAGGAACCTGGGCTTGATTCTGGAGATCGCGGTGAGCGGAGACGGAGCCTCAGCCCCGG
GGAGCACGGGGCCACAGAGCCCCTGTGCCGGCATCGACTCTTTCCTGGATACCTCTCTCCTGGTGGTGACTCTCAGCCA
GCAGCAGTGCGGGGCCTCCAGGAGGAGGAGGAGTGCTTACAACGTCCCCGTCACACCGAGCAACCTCTGCAAGCCCCGA
CGCCTTTACATCAGCTTCAGTGACGTTGGCTGGGAGAATTGGATCATCGCCCCGCAGGGCTACATGGCCAACTACTGCC
TGGGCGAGTGCCCCTTCCCCCTCACAGCTGAGCTCAACAGCACCAACCACGCCATCCTGCAGACCATGGTGCACTCACT
GGACCCCGAGGGGACGCCCCAGCCCTGCTGCGTCCCCGTCAGGCTGTCCCCCATCTCCATCCTCTACTATGACAACAGT
GACAACGTGGTGCTGAGGCACTACGAGGACATGGTGGTGGATGAGTGTGGCTGCAGATAGCGGAGTGGATGTGGGTATG
TGCTGTGGGGTCCCGTGTGGCACACGGAATGATGGATGGAATAAATCCAAGTGTGACA
CitationShah SB, Skromne I, Hume CR, Kessler DS, Lee KJ, Stern CD, Dodd J (1997). Misexpression of chick Vg1 in the marginal zone induces primitive streak formation. Development. 1997 Dec;124(24):5127-38.
CopyrightPrinted in Great Britain © The Company of Biologists Limited 1997
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # U55871 ). GDF3 is the official gene name for VG1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
stage X
stage XI
stage XI
stage XII
Early Embryo
Epiblast
posterior blastoderm
1-3
stage 1
stage 1
stage 3
Primitive Streak
 
4-6
stage 4
stage 4
stage 6
stage 6
Hensen's Node
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Rhombomeres
 
7-12
stage 10
stage 10
Rhombomeres
Somatic Mesoderm
Somites
 
13-17
stage 14
stage 14
stage 17
stage 17
Diencephalon
Notochord
Somites
Spinal Cord
 

Entry 4

GEISHA IdGDF3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GCACAGCACTGCTCTTTGTCTGTGGGTAGGAAAGCAGAGCGATGTGGTGGCCTCTCCCTGCGTGTGCCAGCTTTGGAGC
TGGCCTTGCCTGGGCTCTCCTTACTGTGGCTCTGGGGATGGATTTAAGTTTGCAGGAAAGTTTGCTGTTAAAATCCCTG
GGTCTGAGCGCAAAGCCCAGCCCCAAAATCCCCATCCCGGTGCCATCTGTGCTCTGGAGGATCTTCCAGAAGAGAAGGA
GCCCTCCTGCAACAAACAGAGACCCGGTGGATGGTTGTAGGGTGGAGGAGTTTAATGTCCCTGGGAACATCATCCGTGT
CTTCGCTGACCAAGGCCGCTTCATTCATAGCACGCAGCCCCATCCGCTGCTGTGTCTGCAGAAGCGTCTGTACTTTAAC
CTCTCTGTGCTGGAGGAGGATGAGCGCCTGACCATGGCTCAGCTGGAGATCAAATTCAGCCACAATTCGTACCACAGCC
CCGGCCGGGGGGGGGGCTTCGAGCTGAGGCTGTACCGCAGCTGCCCGGTGCCGCTGAGGGGGACGCCCTCCCTGGAGCG
AGGCCGCAAGCTGCTGCTGGAGCAGTCCTTTGCCCGCCTGCACAAGTCTCTGCTCTTCAACCTGAGCGACGTGGCAAAG
GACTGGACAACTCACAGCAGGAACCTGGGCTTGGTCCTGGAGATCGCGGTGAGCGGAGACGGAGCCTCAGCCCCGGGGA
GCACGGGGCCACAGAGCCCCTGTGCCGGCATCGACTCTTTCATGGATACCTCTCTCCTGGTGGTGACTCTCAGCCAGCA
GCAGTGCAGGGCCTCCAGGAGGAGGAGGAGTGCTTACAACGTCCCCGTCACACCGAGCAACCTCTGCAAGCCCCGGCGC
CTTTACATCAGCTTCAGTGACGTTGGCTGGGAGAATTGGATCATCGCCCCGCAGGGCTACATGGCCAACTACTGCCTGG
GCGAGTGCCCCTTCCCCCTCACAGCTGAGCTCAACAGCACCAACCACGCCATCCTGCAGACCATGGTGCACTCACTGGA
CCCCGAGGGGACGCCCCAGCCCTGCTGCGTCCCCGTCAGGCTGTCCCCCATCTCCATCCTCTACTATGACAACAGTGAC
AACGTGGTGCTGAGGCACTACGAGGACATGGTGGTGGATGAGTGTGGCTGCAGATAGCGGAGTGGATGTGGGTATGTGC
TGTGGGGTCCCCGTGTGGCACACGGAATGATGGATGGAATAAATCCAAGTGTGACAAATGCTCTCTGTGATGGTGTTCA
GGGAGTTTCCCATTGGGACAGGGACTGTCAGAGCCCCCTCTGTGCTGCCTTCTTCCCCTGCAGCCAGGGAGGAGGTCTG
CATGAAGGGATGGGGACAGCTGTGTTTTAGTGGTAGTGCTGTGCTGGGTGCTCTGCCAGAGCCTGCAGGTGGGTACGGG
GTTATGATCAGCTCTGACCCTGGGTGCTGCTCAGCCATGCGGTGTGGTTGGCAGAGGCACCAGGCTGGGAATCCCGGCT
CCGTCCTGTGCCTGGCAGAGCAGCTGCTGGTGCTGCTGGCGGCCTCGTGGTGGAGCTGCTGCCGGGCTTTGTGTTTTTC
AGCTTTTTGCAGCTTATGCCATGCAAAACGCAGTGACCCATTTGGTGAAGTGATGCTGTGGGTCTGTGCTGCCGGCTTC
AGCTGCAGCAGCTGCAGGAAGAGGTATGGTGTCGTGACATGAGCCGTGTCATGACTGAATCCCTTCCCCGGGGCACTGG
AGGCTGCTTCACGCTGGAGCTGTGGCTGTATGGTGGTGTACCTGGAGCTGAGTCATCCCTTGCATTGCTTTTGTAGAGG
GTTTGTCTGCATCAGCTTCTGTGGAGCAGCACAGGAAAGGGGCCGGGATGGGCACTGTGGCTGAGGAAGGGGCACACAG
TGCTGCACAGTGGGCAGCAGCAGTCTGTGGCATTTTGATCCCTCCCTGAGGTCCCACTGCTGCAGCACAGTGCTCATTT
ACCTCGTTGAGCAAAGTAATGAGTGCAGGAGCCCCCGGGCAGCTGCAGCCACATGGCACAGTGCAGCAGTCGCTTTGCA
CAGCAGTGTCACAGCCCTCATAATTCAGGCACCACATTAATAATGTGCATATGCATTTGGGGGTTATTTTTTATGTGTT
TGGCTTATTGTTTTTATTAAGGACTTGTGCGCAGAGCTGCAGCTGTTGGCTGTGCTCCTCAGTCCATTGCAGCAGTGTG
GCTGTGCTCTCGCCGTGTTTCATGCCATGAACAGAAGCCCTCAGAGCAGTGTGGGGGGGAGGGGGTGCAGACACAGAAT
CTGAGTTAACTTGAATTTCTTTTTGAAATATGAGCCCGGCAGCACAGCCTGCACCGTTTCTACTTTTTTTGTACCTGTG
TTGTATTGTCTCCAAGATCTGATGAAGTATTGCTGAGTGCAGCTGGACCCCAAGCACTGAGGGTTTAAACCACTGCCAG
AGCTGCAGCGGAGCGTCTTCCTGCAACACCACTGCTGCCATGCCTGAACCATGCAGCGGAAGGCCGAGTAGGTTGAGAA
CAGCCCTTAGGTTGGTAGCACTCACCTTCAGCTTCCCCACACCCAGCAGTAACCCCTAACATAGCGCAGTGAAAGCAGT
GTCCCCCCCCTGGGGGTGTCAGGAGCTTTGGGTGGGACATAACCCAGCAGGAGCTCTTTCTTTCCAGATTAGAACAGCA
GGGATTTAAAAACCACCCCCTTCCTTTTGGTACTGTGCTGGAGTGGACTCAGGGAGGCAGAGCTGTTATTGGCTCCAGG
CTGAGCGCAGCTGAGCACCCACCCAGGAACTGCATTTGCTTCCATGTGTCCGCTCTGCGCCCCCCCACTTTTGTACCAG
TCTGTGTGTAAAGGAAGTAATAAACTTGAAGTTTCTACAATCA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI ( NM_205211).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Outflow Tract
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4324

Mouse

EmageMGI:95686
EurexpressMGI:95686
MGI GXDMGI:95686

Frog

Xenbase487308

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-389
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona