GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GJB6
gap junction protein beta 6

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolGJB6
Official Full Namegap junction protein beta 6
CGNC ID49469
also known asCX31, gap junction beta-6 protein|connexin 31|gap junction protein, beta 6 (connexin 30)|gap junction protein, beta 6, 30kDa
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204931
PolypeptideNP_990262
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1951
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10804ENSG00000121742MIM:601544MIM:604418
Mouse14623ENSMUSG00000040055All phenotypic alleles (3):Targeted, other(3) MGI:107588
Xenopus
Zebrafish404725ENSDARG00000042707ZDB-GENE-040406-1ZFIN:ZDB-GENE-040406-1
Gene Ontology
Molecular Functiongap junction channel activity
Biological Processcell-cell signaling, sensory perception of sound
Cellular Componentconnexon complex, integral component of membrane
Links to other databases
Entrez Gene395771
Ensembl Gene
KEGGgga:395771

Entry 1

GEISHA IdGJB6.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-TCGCTCCCACAGGTCATAC-3’
Reverse cDNA Template Primer5’-AATTAACCCTCACTAAAGGGCACTGACACCACCTTAGC-3’cDNA Template Length838
Complete cDNA Template Probeshow
TCGCTCCCACAGGTCATACCTTTAAGACAGACATGGATTGGGGAGCTCTGCAGACCATCTTAGGAGGTGTAAATAAACA
CTCCACCAGCATTGGGAAGATATGGCTCACAGTCCTGTTCATCTTCCGTATCATGATCCTGGTTGTGGCTGCAGAGAGA
GTCTGGGGAGATGAACAAGATGACTTTATCTGCAACACTTTGCAACCTGGTTGCAAAAATGTTTGCTATGATCACTTTT
TCCCCATCTCTCACATCAGACTCTGGGCCCTGCAGCTGATCTTCGTCTCTACCCCTGCGCTGCTGGTGGCCATGCACGT
GGCTTACAGGAGACACGAGAAGAAAAGGCAGTTCAGAAAGGGAGACCAGAAATGCGAGTATAAGGACATTGAAGAAATC
AGAACCCAGAGGTTTCGTATTGAGGGCACCCTGTGGTGGACGTACACTTGCAGCATCTTCTTCAGATTGGTCTTTGAAG
CAGTCTTCATGTATGCATTTTATTTCATGTATGATGGGTTCCGAATGCCTCGCTTAATGAAATGTAGTGCTTGGCCCTG
CCCCAACACAGTAGACTGCTTTGTTTCTCGACCTACTGAAAAGACAGTGTTCACTATTTTCATGATTGCTGTGTCCAGC
ATTTGCATTCTTTTAAATGTGGCTGAATTATGTTATTTACTGACAAAATTTTTTCTCAGAAGGTCTAGAAAAGCTGGAA
ATCAGAAACACCACCCCAACCATGAGAATAAAGAAGAAACCAAACAAAATGAAATGAACGAGTTAATATCTGATAGCTG
TCAGAACACAGTTATAGGATTCACAAGTAGCTAAGGTGGTGTCAGTGC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Unlabeled
 
7-12
stage 8
stage 10
stage 12
Area Opaca
Unlabeled Embryonic
 
19
stage 19
stage 19
Foregut
Head Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
 

Entry 2

GEISHA IdCONNEXIN31.Heller.1998Data SourcePublication
Complete cDNA Template Probeshow
GATCAAACCCGGCGCTGCGGGCTGGGACCCACGCTGCTCCTGCCGGCCCCCACTCGGTCCTGCCGCTCCCCCTCTTTTT
TTGAGGAATCTCTTCCTTAAGGAAAATCTCCGCCAGTTGGCGAGGCGTTCCTGGGACGGGCTGCCCGGGGAGGTGGCGG
AAGCATCGCTCCCACAGGTCATACCTTTAAGACAGACATGGATTGGGGAGCTCTGCAGACCATCTTAGGAGGTGTAAAT
AAACACTCCACCAGCATTGGGAAGATATGGCTCACAGTCCTGTTCATCTTCCGTATCATGATCCTGGTTGTGGCTGCAG
AGAGAGTCTGGGGAGATGAACAAGATGACTTTATCTGCAACACTTTGCAACCTGGTTGCAAAAATGTTTGCTATGATCA
CTTTTTCCCCATCTCTCACATCAGACTCTGGGCCCTGCAGCTGATCTTCGTCTCTACCCCTGCGCTGCTGGTGGCCATG
CACGTGGCTTACAGGAGACACGAGAAGAAAAGGCAGTTCAGAAAGGGAGACCAGAAATGCGAGTATAAGGACATTGAAG
AAATCAGAACCCAGAGGTTTCGTATTGAGGGCACCCTGTGGTGGACGTACACTTGCAGCATCTTCTTCAGATTGGTCTT
TGAAGCAGTCTTCATGTATGCATTTTATTTCATGTATGATGGGTTCCGAATGCCTCGCTTAATGAAATGTAGTGCTTGG
CCCTGCCCCAACACAGTAGACTGCTTTGTTTCTCGACCTACTGAAAAGACAGTGTTCACTATTTTCATGATTGCTGTGT
CCAGCATTTGCATTCTTTTAAATGTGGCTGAATTATGTTATTTACTGACAAAATTTTTTCTCAGAAGGTCTAGAAAAGC
TGGAAATCAGAAACACCACCCCAACCATGAGAATAAAGAAGAAACCAAACAAAATGAAATGAACGAGTTAATATCTGAT
AGCTGTCAGAACACAGTTATAGGATTCACAAGTAGCTAAGGTGGTGTCAGTGCTGATATTCACTCCGAAAAGGGTGAGT
GTTCTTTGTCTAAAGGCTGCAAATAAGATTTGTTATACTAAACAGCTAACGCTGGGAGAGATTTAGATGTGTAGTGACA
GGTGTCAATTATGCATCTGTTGGGGGGAAAAAAGGCAGCTTAAACTTTTGAACATTATGAGGATTAAATAGGAAAGTGT
ATTTTCCTATGGCAATCCTTACAAGTTGACTATGACAAGTGCACTAGTGCCTTCGTGCAGATACAGTTCCTGAA
CitationHeller S, Sheane CA, Javed Z, Hudspeth AJ. Molecular markers for cell types of the inner ear and candidate genes for hearing disorders. Proc Natl Acad Sci U S A. 1998 Sep 15;95(19):11400-5.
CopyrightCopyright © 2012 National Academy of Sciences. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #AF072699.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-43
stage 43
stage 43
Ear/Otic Placode
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1951

Mouse

Emage
EurexpressMGI:107588
MGI GXDMGI:107588

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040406-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona