GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GLI3
GLI family zinc finger 3

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolGLI3
Official Full NameGLI family zinc finger 3
CGNC ID9366
also known asGLI3FL, transcriptional activator GLI3|GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)|GLI3 full length protein, GLI3 , GKLF
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001271903
PolypeptideNP_001258832
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3297
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2737ENSG00000106571MIM:200990MIM:165240
Mouse14634ENSMUSG00000021318All phenotypic alleles (21):Targeted, knock-out(3) Targeted, other(6) Transgenic(2) Spontaneous(4) Chemically induced(1) Radiation induced(5) MGI:95729
Xenopus100101789, 397837484854
Zebrafish403042ENSDARG00000052131ZDB-GENE-041111-162ZFIN:ZDB-GENE-041111-162
Gene Ontology
Molecular FunctionDNA binding, metal ion binding
Biological Processlimb development, negative regulation of transcription, DNA-templated, transcription, DNA-templated
Cellular Componentcytoplasm, nucleus
Links to other databases
Entrez Gene420769
Ensembl Gene
KEGGgga:420769

Entry 1

GEISHA Id42QData SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAGTTCTTTCGGCATGCAGCCCA
ATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGTTCCTGTGGCATAACAGTTCA
AGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTCATCCCATCGCATCCAGTGAT
CAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTTGCAAAACGAACTGGTTGGAG
ATGGCATTCATTACCAGAGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGTCCTACCTCACAAAGCAGCCT
CCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAGGTTTGTCAGTGGCCAAGAGT
TACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCTGGCACAACAGCAAGGACATG
TAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAGTCACAGCAGTTCTGCTCTAA
TTATGCAGAATTACTCTGGTCAGTTATATGACCAANACACAGGCTTTAGCCACCAAGCTATGAAAATAG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Primitive Streak
 
4-6
stage 4
Primitive Streak
 
7-12
stage 9
stage 10
stage 10
stage 11
stage 12
Forebrain
Hindbrain
Isthmus/MHB
Midbrain
Neural Plate/Tube
Primitive Streak
Spinal Cord
 
13-18
stage 13
stage 14
stage 14
Neural Plate/Tube
Widespread Expression
 
19-24
stage 20
stage 21
stage 24
Limb Buds
Mesoderm
Widespread Expression
 

Entry 2

GEISHA IdGLI3.Aglyamova.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationAglyamova GV, Agarwala S. Gene expression analysis of the hedgehog signaling cascade in the chick midbrain and spinal cord. Dev Dyn. 2007 May;236(5):1363-73
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_418866).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
stage 10
stage 10
stage 10
Hindbrain
Midbrain
Neural Plate/Tube
Spinal Cord
 
13-18
stage 15
Midbrain
Neural Plate/Tube
Tectum
25-26
stage 26
stage 26
stage 26
Isthmus/MHB
Midbrain
Neural Plate/Tube
Tectum

Entry 3

GEISHA IdGli3.vonFrowein.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
TCTGTACCTTATCGTGGGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACC
TCTTTCCAGCGTTCCACCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCAT
TCCTCCTTTGCATGTGCCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACAC
AGAAATCCTGCTGCAGCATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCT
CCTTGCACAGCAGCCCATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGT
CAGTCCAGCTGAATATTATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCT
GCCACTGCTGGAGCTGGTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTAT
CAGCTAGACCAAGCCGAAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACG
GACATCTCCAAATTCCTTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTA
TCTGCAAGCGCAATAAGCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAA
TTATAAGTCGTCAGCAAACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTAC
CCAGAGACCTATCCCTGGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAG
AACAAACCCACAAGTGAGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATG
AGGACCTCCCCAGCCCGGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAA
AGATGAAAGCAAACAGGAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACA
CAGGAACAGCTAGTGCATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACT
GTTCCCGGGAGCAGAAACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACA
CAAATGCACTTTTGAAGGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGA
GAGAAACCATATGTGTGCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACA
GGACTCATTCAAATGAAAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCG
GAAACATGTGAAGACTGTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCA
CCACCCAGAGACCCAGGCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGG
ACCTCAACAGCACTACCTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCA
GCCAAGCCCTGGTGGTCAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTT
ACTCTGACTGGTGGCGGTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAG
CCACCACAGCACTTGGCTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTT
GAAACAAGTTAATGGAATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGA
AATGGTACCCAATCAAACAGCAGCTGCAGTGTAGGAGGATCC
CommentsAccording to the authors, “Plasmid templates were used to generate digoxygenin antisense riboprobes: Gli3 (C. Tabin) (Schweitzer et al., 2000). The sequence below came from Schweitzer (Acc# AF303886).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
Forebrain
 

Entry 4

GEISHA IdGLI3.Granata.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationGranata A, Quaderi NA. Asymmetric expression of Gli transcription factors in Hensen's node. Gene Expr Patterns. 2005 Apr;5(4):529-31. Epub 2004 Dec 15.
CopyrightReprinted with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_418866).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Area Pellucida
Ectoderm
Hensen's Node
Neural Plate/Tube
Anterior
7-8
stage 7
stage 8
stage 8
Area Pellucida
Hensen's Node
Neural Plate/Tube
Figure 1 includes HH stages 4-8 and compares the expression of Gli genes in Hensen's node.
Mesendodermal Layer of Hensen's Node

Entry 5

GEISHA IdGLI3.Agarwala.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationAgarwala S, Aglyamova GV, Marma AK, Fallon JF, Ragsdale CW. Differential susceptibility of midbrain and spinal cord patterning to floor plate defects in the talpid2 mutant. Dev Biol. 2005 Dec 1;288(1):206-20. Epub 2005 Oct 21.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_418866).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
Midbrain
Neural Plate/Tube
Spinal Cord
 
25-26
stage 26
stage 26
Isthmus/MHB
Midbrain
Dorsoventral border of the midbrain
Midbrain dorsoventral
Tectum
midbrain–forebrain boundaries

Entry 6

GEISHA IdGli3.Liu.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationLiu G, Moro A, Zhang JJ, Cheng W, Qiu W, Kim PC. The role of Shh transcription activator Gli2 in chick cloacal development. Dev Biol. 2007 Mar 15;303(2):448-60. Epub 2006 Dec 15
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # XM_418866.2)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Leg
 
19-24
stage 22
stage 22
Leg Ectoderm
Neural Plate/Tube
Unlabeled
 
25-30
stage 28
stage 28
stage 30
stage 30
Leg
Neural Plate/Tube
Unlabeled
 
31-36
stage 36
stage 36
Leg Ectoderm
Leg Mesenchyme
Spinal Cord
Unlabeled
 

Entry 7

GEISHA IdGLI3.Meyer.2003Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationMeyer NP, Roelink H. The amino-terminal region of Gli3 antagonizes the Shh response and acts in dorsoventral fate specification in the developing spinal cord. Dev Biol. 2003 May 15;257(2):343-55.
CopyrightCopyright © 2003 Elsevier Science (USA). All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_418866).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Neural Plate/Tube
Primitive Streak
 

Entry 8

GEISHA IdGLI-3.Pacifici.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationPacifici M, Koyama E, Iwamoto M. Mechanisms of synovial joint and articular cartilage formation: recent advances, but many lingering mysteries. Birth Defects Res C Embryo Today. 2005 Sep;75(3):237-48.
CopyrightCopyright © 2005 Wiley-Liss, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #XM_418866).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-36
stage 36
stage 36
stage 36
stage 36
stage 36
Limb Buds
 

Entry 9

GEISHA IdGLI3.Luo.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAGACATGGAAA
AAA
CitationLuo J, Ju MJ, Redies C. Regionalized cadherin-7 expression by radial glia is regulated by Shh and Pax7 during chicken spinal cord development. Neuroscience. 2006 Nov 3
Copyright© 2006 IBRO. Published by Elsevier Ltd. All rights reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
Spinal Cord
 

Entry 10

GEISHA IdGli3.Schweitzer.2000Data SourcePublication
Complete cDNA Template Probeshow
TCTGTACCTTATCGTGGGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACC
TCTTTCCAGCGTTCCACCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCAT
TCCTCCTTTGCATGTGCCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACAC
AGAAATCCTGCTGCAGCATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCT
CCTTGCACAGCAGCCCATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGT
CAGTCCAGCTGAATATTATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCT
GCCACTGCTGGAGCTGGTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTAT
CAGCTAGACCAAGCCGAAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACG
GACATCTCCAAATTCCTTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTA
TCTGCAAGCGCAATAAGCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAA
TTATAAGTCGTCAGCAAACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTAC
CCAGAGACCTATCCCTGGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAG
AACAAACCCACAAGTGAGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATG
AGGACCTCCCCAGCCCGGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAA
AGATGAAAGCAAACAGGAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACA
CAGGAACAGCTAGTGCATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACT
GTTCCCGGGAGCAGAAACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACA
CAAATGCACTTTTGAAGGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGA
GAGAAACCATATGTGTGCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACA
GGACTCATTCAAATGAAAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCG
GAAACATGTGAAGACTGTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCA
CCACCCAGAGACCCAGGCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGG
ACCTCAACAGCACTACCTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCA
GCCAAGCCCTGGTGGTCAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTT
ACTCTGACTGGTGGCGGTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAG
CCACCACAGCACTTGGCTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTT
GAAACAAGTTAATGGAATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGA
AATGGTACCCAATCAAACAGCAGCTGCAGTGTAGGAGGATCC
CitationSchweitzer R, Vogan KJ, Tabin CJ. Similar expression and regulation of Gli2 and Gli3 in the chick limb bud. Mech Dev. 2000 Nov;98(1-2):171-4.
CopyrightCopyright © 2000 Elsevier Science Ireland Ltd.
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Schweitzer et al. 2000.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Neural Plate/Tube
 
7-12
stage 8
Neural Plate/Tube
 
19-24
stage 19
stage 20
stage 20
stage 20
stage 20
stage 21
stage 21
stage 21
stage 22
stage 22
stage 24
stage 24
stage 24
stage 24
Diencephalon
Hindbrain
Leg
Leg AER
Leg Mesenchyme
Limb Buds
Midbrain
Somites
Telencephalon
 
25-30
stage 26
Leg AER
 
31-44
stage 44
stage 44
  

Entry 11

GEISHA IdGLI3.Singh.2016Data SourcePublication
Complete cDNA Template Probeshow
TCTGTACCTTATCGTGGGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACC
TCTTTCCAGCGTTCCACCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCAT
TCCTCCTTTGCATGTGCCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACAC
AGAAATCCTGCTGCAGCATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCT
CCTTGCACAGCAGCCCATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGT
CAGTCCAGCTGAATATTATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCT
GCCACTGCTGGAGCTGGTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTAT
CAGCTAGACCAAGCCGAAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACG
GACATCTCCAAATTCCTTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTA
TCTGCAAGCGCAATAAGCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAA
TTATAAGTCGTCAGCAAACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTAC
CCAGAGACCTATCCCTGGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAG
AACAAACCCACAAGTGAGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATG
AGGACCTCCCCAGCCCGGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAA
AGATGAAAGCAAACAGGAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACA
CAGGAACAGCTAGTGCATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACT
GTTCCCGGGAGCAGAAACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACA
CAAATGCACTTTTGAAGGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGA
GAGAAACCATATGTGTGCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACA
GGACTCATTCAAATGAAAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCG
GAAACATGTGAAGACTGTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCA
CCACCCAGAGACCCAGGCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGG
ACCTCAACAGCACTACCTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCA
GCCAAGCCCTGGTGGTCAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTT
ACTCTGACTGGTGGCGGTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAG
CCACCACAGCACTTGGCTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTT
GAAACAAGTTAATGGAATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGA
AATGGTACCCAATCAAACAGCAGCTGCAGTGTAGGAGGATCC
CitationSingh PN, Ray A, Azad K, Bandyopadhyay A. A comprehensive mRNA expression analysis of developing chicken articular cartilage. Gene Expr Patterns. 2016 Jan;20(1):22-31.
CopyrightCopyright © 2015 Elsevier B.V. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Singh et al. 2016.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 28
Limb Buds
 
31-38
stage 31
stage 34
stage 36
stage 38
Limb Buds
 
all
 
  

Entry 12

GEISHA IdGLI3.Kahane.2013Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGGAGGCGCAGTCCCATAGCTCTACCACGACAGAGAAGAAAAAAGTGGAGAATTCCATTGTGAAATGCTCCAATCGAA
CAGATGTCAGTGAGAAAGCTGTTGCCTCCAGCACAACTTCCAATGAGGATGAAAGTCCTGGACAGACCTATCACAGAGA
GAGAAGGAACGCAATCACAATGCAGCCACAAGGTGGGCAAGGCCTCAGCAAGATCAGTGAGGAGCCTTCAACATCTAGC
GAGGAAAGGGCCTCATTAATAAAGAAAGAGATCCATGGATCTATATCGCACCTTCCTGAACCTTCTGTACCTTATCGTG
GGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACCTCTTTCCAGCGTTCCA
CCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCATTCCTCCTTTGCATGTG
CCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACACAGAAATCCTGCTGCAG
CATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCTCCTTGCACAGCAGCCC
ATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGTCAGTCCAGCTGAATAT
TATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCTGCCACTGCTGGAGCTG
GTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTATCAGCTAGACCAAGCCG
AAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACGGACATCTCCAAATTCC
TTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTATCTGCAAGCGCAATAA
GCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAATTATAAGTCGTCAGCA
AACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTACCCAGAGACCTATCCCT
GGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAGAACAAACCCACAAGTG
AGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATGAGGACCTCCCCAGCCC
GGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAGAGATGAAAGCAAACAG
GAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACACAGGAACAGCTAGTGC
ATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACTGTTCCCGGGAGCAGAA
ACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACACAAATGCACTTTTGAA
GGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGAGAGAAACCATATGTGT
GCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACAGGACTCATTCAAATGA
AAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCGGAAACATGTGAAGACT
GTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCACCACCCAGAGACCCAG
GCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGGACCTCAACAGCACTAC
CTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCAGCCAAGCCCTGGTGGT
CAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTTACTCTGACTGGTGGCG
GTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAGCCACCACAGCACTTGG
CTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTTGAAACAAGTTAATGGA
ATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGAAATGGTACCCAATCAA
ACAGCAGCTGCAGTGTAGGAGGATCCATGACTATTCTGCCAAACAGGAATGAACTTTCTAGTACAGACATCACTGTGTT
GAACATGCTTAACAGGAGGGACAGCAATACGAGCACAATCAGTTCAGCCTACTTGAGCAGCCGCAGGTCTTCTGGAATC
TCACCTTGCTTCTCCAGCCGGAGGTCCAGTGATGCCTCTCAGGCTGAGGGAAGACCACAAAATGTGAGCGTTGCAGACT
CCTATGACCCCATTTCAACGGATGCCTCTCGGCGCTCAAGTGAAGCAAGCCAATGTGATGACCTGCCAAGTCTTCTCAG
CCTCACCCCAGCCCAGCAATACAGGCTGAAAGCTAAATATGCAGCAGCTACTGGTGGACCCCCACCAACTCCACTGCCT
AATATGGAGAGGATGAGCCTCAAAACAAGGATGGCACTCTTGGGTGACTGCAGGGAGTCTGGAATATCTCCACTGCCTC
CAGTGAATGCCCCTAGAAGATGTAGTGATGGTGGGGCAAATGGTTACAGCAGGAGGCATCTTCTATCTCATGATGCTCT
AGGAAATGGGACAAGGAGAGCCAGTGATCCAGTAAGAATGGTCTCCAATAACCTCTCTGTCCCTAGAGTCCAACATTTC
AACAGTCTTAATAGCTTTAACTCTCCTGCTTTGCCTCCATCCATGGAAAAGCGCAACCTTGTCCTTCAGAACTGTACCC
ATTCTGAGGGTGGTGTTTTCCGTGGCTTCAGTTCCCCCTGTCCTCCAAGCATCAGCGAGAACGTCACCCTGGAGGCTGT
TACGATGGAAGCAGGTGGCAGTTTGAATGATGAGGATCTCCTGCCAGATGATGTGGTTCAGTATCTGAATTCCCAGAAC
CAGGGCACGTGCGACCACTTGTTGAACAATGTCCTAGACAGCAACAAAATGCATCACAGTGTGGTTTTAGGAAACAACA
ATCCCAGCAGCTTTGATCGAGCCCCTCCAGCAAGCAGTCAGCCTGCAGGCTCAGAGGTAAGCAAGAGTGACTTACCCAT
TCAGTGGAATGAAGTAAGCTCAGGAAGTTCTGACTTATCTCCTACAAAACTGAAATGTAGTCAGCGCTCAGCAGTGCAG
CAGGCTAGAGCATTTGGACTGTATAACAACATGATCGTTCAGCAGCAGAACTTGCAGAGAGGCAATGTGTACCAGCAAA
ATGGCTATCAGAACCTGATGGAAAACAATGGTTCCTATAGTTTGCAGCAGAACACGGTCCTTGGCAGCGGAGCCAGTAG
TTCTTTCGGCATGCAGCCCAATAAGCCTTATGGTGAAAGCGTCAGCAGGCAACCTATGATTTTTGGGGCAATGGACAGT
TCCTGTGGCATAACAGTTCAAGGGCAGAAGCTAAGAAGCAGCAACATGCCAGTGAGTGGGAACCAGCAAAATTTTGGTC
ATCCCATCGCATCCAGTGATCAAGCCACCAGTATGGCAAATGGGATGCAAAACAGGAATGTGATGGAACAGGAATATTT
GCAAAACGAACTGGTTGGAGATGGCATTCATTACCAGGGAGTCAATCAGTCCAGTCCAATGACACTAGGGCAGGTTAGT
CCTACCTCACAAAGCAGCCTCCATCAGGGGCCACAGAGTTGTCCTCCGGTATCTCATACCATTGGTAACCAGTCTTCAG
GTTTGTCAGTGGCCAAGAGTTACCAGCCATGTGCTAATTACAGTGGCAACAGACGGCAAAATGTGTTGAGGAACAACCT
GGCACAACAGCAAGGACATGTAAGTGATGGCAACCAGACGTACAGGGTAAACACCATTAAATTGGAGATGCAAGGTCAA
TCACAGCAGTTCTGCTCTAATATGCAGAATTACTCTGGTCAGTTATATGACCAAACCACAGGCTTTAGCCACCAAGCTA
TGAAAATAGGTTCTTCTTTCTTTGTTTCGGAAGCTAACTGCCTGCTGCAGGAGACTGCTACTGCAAACTCCTCTGAGCT
TCTTTCCCCGGGGGCTAACCAAGTATCAAGCACAGTTGACAGCCTTGACAGCAACAGCCTAGAGGGTGTGCAGATTGAT
TTTGATGCTATCATAGATGATGGAGACCATGTCAGCTTAATTTCAGGAGCCCTGAGCCCAAGCATCATTCAGAATCTCT
CCCGCAATTCCTCACGCCTCACCACTCCCCGAGCGTCTCTTACCTTCCCAGCTATGCCTGTAAGCACAACCAACATGGC
TATTGGGGACATGAGTTCTTTGTTGACCTCACTTGCAGAAGAAAGCAAGTTTCTTGCTGTTATGCAATAG
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_001271903.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
Dermomyotome
 
all
 
  

Entry 13

GEISHA IdGLI3.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
TCTGTACCTTATCGTGGGACATTGTTTACTATGGACCCCAGAAATGGTTACATGGATCCTCATTACCATCCACCTCACC
TCTTTCCAGCGTTCCACCCTCCTGTACCAATTGATGCGCGACATCATGAGGGACGCTACCATTATGAACCATCTCCCAT
TCCTCCTTTGCATGTGCCTTCTGCCTTATCTAGTAGCCCAACATATTCAGATCTTCCATTCATTAGAATTTCCCCACAC
AGAAATCCTGCTGCAGCATCAGAGTCTCCCTTCAGCACTCCTCACCCGTACATTAACCCATACATGGACTATATCCGCT
CCTTGCACAGCAGCCCATCCCTGTCCATGATCTCAGCAGCCCGTGGACTCAGCCCAACAGACGCTCCCCATGCTGGCGT
CAGTCCAGCTGAATATTATCATCAGATGGCTCTGTTGGCAGGCCAGCGCAGCCCTTACGCAGACATCATTCCTTCAGCT
GCCACTGCTGGAGCTGGTGCTCTTCATATGGAATATCTTCACGCCATGGATAGCACCAGGTTTCCGAGTCCAAGATTAT
CAGCTAGACCAAGCCGAAAGCGTACGTTGTCTATATCCCCCCTATCTGATCACAGCTTTGACCTTCAGACCATGATACG
GACATCTCCAAATTCCTTGGTCACAATTCTCAATAATTCTCGTAGCAGTTCGTCAGCCAGTGGTTCTTATGGCCACTTA
TCTGCAAGCGCAATAAGCCCTGCTCTGAGTTTCACATACCCTCCTACACCGGTATCCCTCCAGCAAATGCATCAGCAAA
TTATAAGTCGTCAGCAAACCCTGGGTTCTGCCTTTGGACACAGCCCTCCTCTCATCCATCCTGCTCCAACTTTTCCTAC
CCAGAGACCTATCCCTGGCATCCCCAGTGTCCTGAACCCTGTCCAGGTCAGCTCTGGACCTTCTGAGTCCACACAGCAG
AACAAACCCACAAGTGAGTCTGCAGTGAGCAGCACTGGGGATCCAATGCACAACAAGCGCTCCAAGATAAAGCCGGATG
AGGACCTCCCCAGCCCGGGTGCGGGAAGCGTGCAGGAACAGCCAGAAGGTATGACCCCGGTAAAGGAGGAAGGGGACAA
AGATGAAAGCAAACAGGAGCCTGAAGTGGTCTACGAGACGAACTGCCATTGGGAAGGCTGTTCCCGGGAGTTTGACACA
CAGGAACAGCTAGTGCATCATATAAATAATGACCACATACATGGTGAGAAGAAAGAGTTTGTGTGCCGATGGCTGGACT
GTTCCCGGGAGCAGAAACCATTCAAAGCCCAGTATATGCTGGTGGTCCACATGAGGAGACATACAGGGGAAAAGCCACA
CAAATGCACTTTTGAAGGTTGTACAAAGGCCTACTCCAGACTAGAAAACTTGAAAACACACTTGAGATCTCACACTGGA
GAGAAACCATATGTGTGCGAACACGAGGGCTGCAACAAAGCTTTCTCCAATGCATCTGACAGGGCCAAGCACCAAAACA
GGACTCATTCAAATGAAAAACCATATGTTTGCAAGATCCCAGGCTGCACAAAGCGCTATACAGACCCTAGTTCTCTCCG
GAAACATGTGAAGACTGTGCATGGCCCAGAAGCACACGTCACCAAGAAGCAGCGAGGAGACATCCACCCAAGGCCTCCA
CCACCCAGAGACCCAGGCAGCCACTCTCAGACACGATCACCAGGCCAGCAGACTCAGGGTGCGACTGGGGAGCAGAAGG
ACCTCAACAGCACTACCTCAAGGCGTGAAGAATGCCTCCAAGTGAAAGCAGTCAAGTCAGAGAAACCAATGACATCTCA
GCCAAGCCCTGGTGGTCAGTCTACATGCAGCAGCGAACAGTCCCCCATCAGCAACTATTCCAACAATGGGATCGAGCTT
ACTCTGACTGGTGGCGGTAGTGTAGGAGACCTCAGTGTCATCGATGAAACCCCAATCATGGACTCTACCATTTCCACAG
CCACCACAGCACTTGGCTTACAGGCCAGGAGGAATATGACAGGGACCAAATGGATGGAGCAAGTGAAATTAGAAAGGTT
GAAACAAGTTAATGGAATGCTTCCAAGACTGAACCCCGTTCCACCTTCCAAAGCCCCGACCTTGCCGCCTCTCATAGGA
AATGGTACCCAATCAAACAGCAGCTGCAGTGTAGGAGGATCC
CommentsImages and probe sequence information provided by Claire Anderson. Probe sequence is associated with GenBank: AF303886, according to the following article: Mech Dev 2000 Nov;98(1-2):171-4. doi: 10.1016/s0925-4773(00)00458-5. Similar expression and regulation of Gli2 and Gli3 in the chick limb bud. R Schweitzer 1, K J Vogan, C J Tabin.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3297

Mouse

EmageMGI:95729
EurexpressMGI:95729
MGI GXDMGI:95729

Frog

Xenbase484854

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-041111-162
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona