GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GUCA2A
guanylate cyclase activator 2A

Gene
Official SymbolGUCA2A
Official Full Nameguanylate cyclase activator 2A
CGNC ID51015
also known asGUCA2B, guanylate cyclase activator 2A (guanylin)|guanylate cyclase activator 2B (uroguanylin)
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001197038
PolypeptideNP_001183967
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.6086
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419498
Ensembl GeneENSGALG00000027269
KEGGgga:419498

Entry 1

GEISHA IdGUCA2A.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
CTGGGCACGAGGAGAGACACAAAAGAAAGGAGAAAAGATATTCAGGTTAGAAGAGGCTGCTCTTTGCAGGTGCTATGAG
AGGCTTGGTGTCCTTCACAGTCCTTGCACTCCTTTTACTGGTGCACAGCTCCCAGGCAGTCTATGTCCAGGATGGCAAC
TTGAAATTCTCCCTTGAATCTGTGAAGAAGCTAAAGGAGCTTATGGATGAGAACAAAGTCATTAACCCTCGCATAGTGG
TTGCAAAGGCTGGGTATTCTCCATGTCAAGATAAAGCTCTCCCTGAGGAATTCCAACCTGTGTGTAAAAGAGAAGATGC
ACCTATGATTTTCGAGAGGCTG
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST152d9. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Extraembryonic
Neural Plate/Tube
Notochord
Yolk Sack or Stalk
extraembryonic endoderm
HH12-, dorsal view
dorsal view
section 46
section 66
section 8

Entry 2

GEISHA IdGUCA2A.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TTGGGCACGAGGAGAGACACAAAAGAAAGGAGAAAAGATATTCAGGTTAGAAGAGGCTGCTCTTTGCAGGTGCTATGAG
AGGCTTGGTGTCCTTCACAGTCCTTGCACTCCTTTTACTGGTGCACAGCTCCCAGGCAGTCTATGTCCAGGATGGCAAC
TTGAAATTCTCCCTTGAATCTGTGAAGAAGCTAAAGGAGCTTATGGATGAGAACAAAGTCATTAACCCTCGCATAGTGG
TTGCAAAGGCTGGGTATTCTCCATGTCAAGATAAAGCTCTCCCTGAGGAATTCCAACCTGTGTGTAAAAGAGAAGATGC
ACCTATGATTTTCGAGAGGCTGTGCTTGGTTGCCAGTGAAGCTGATTTGTGTGAAATCTGTGCCAATGCTGCCTGCTCT
GGTTGCTTTTGAATAAGGATGAAACAATCCAAAGACAACGTGCCAAACTAGGAAGTTTGTGCATTTGTATTGTAAGATC
ACATAACCTCACAAATCACCTTTTAGGCTTCATCTTCACTGCAGTCAAACTGAAGCTGTTAGCTCATGTAGACATACTA
AGGGTAATTTTGAAGTAGTGAGATCAGGTAATACCAGCAATGCAGTTCTGGCAACAGGAAGACTAAACTTCATCTGAGA
AGCTGAAGAACCATGAAGAACCAAGAACTGAGCATTGTCTTGCCTTGAGCCATGAGCTGTCTATGTGAGCTGTATCATG
CTTGACTGGAGTGAAAATATCCCGGACTCAGTGTTTCAATTTCCAGTATCTTATCTGGATTGGAACCATGATGGGTCAA
ACTGAGTAGTCTCCTCTAGCCTTTTAATATCTAAATCTCCTGTGATCTGGTTTCCACTA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.6086

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona