GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HAND1
heart and neural crest derivatives expressed 1

Gene
Official SymbolHAND1
Official Full Nameheart and neural crest derivatives expressed 1
CGNC ID49492
also known aseHAND, heart- and neural crest derivatives-expressed protein 1|extraembryonic tissues, heart, autonomic nervous system and neural crest derivatives-expressed protein 1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204965
PolypeptideNP_990296
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.478
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular FunctionDNA binding, protein dimerization activity
Biological Processmulticellular organismal development, regulation of transcription, DNA-templated, more...transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene395812
Ensembl GeneENSGALG00000026787
KEGGgga:395812

Entry 1

GEISHA IdHAND1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGCACGAGCCCTTCCTCTTCG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGGCGTCTCCCGTTTCCTCTTGTTCcDNA Template Length449
Forward cDNA Template Probeshow
TTTTTTTCCCTCCTGTTTCGCGGCGTCGCTTTCTTGAGCTCGGCCTTGAAGCCCTCGGGCTCTCCGGGCTGGCTGTCCC
TGGCCAGCACCTCCATCAGGTAGGCGATGTAGCTGGTGGCCAGGCGCAGCGTCTTGATCTTGGACAGCTTGGTGTCGGC
GGGCACGTTGGGGATGCACTCGCGGAGCTCAGCGAAAGCGCTGTTGATGCTCTCCGTTCTCCTCCTCTCCTTTTTGGGA
CCCCCGACCCCTTTCCTTCTCCCCAAACGACCGCTGAGCGCTTCCAGCCTGCCCGCTCCTCCCGAGCCGAACTCGGCGG
GGCCGTACGCGGGGCTCTGCCCGTGGAGCTCCGGGGTCACCTCGGCCGGGTTCAGCACCCAGCCGGGGAAATAAGCGCG
CTCCTGGTGGCAGCGAGCCGCCGGCCCGAAGAGGAAGGGCTCGTGCAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Extraembryonic Mesoderm
Germinal Crescent
 
4-6
stage 4
stage 5
stage 6
Extraembryonic Mesoderm
Germinal Crescent
Headfold
Lateral Plate Mesoderm
 
7-12
stage 7
stage 8
stage 8
stage 9
stage 10
stage 11
stage 12
Allantois
Amnion
Anterior Intestinal Portal
Blood Vessels
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Outflow Tract
Sinus Venosus
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 13
stage 17
stage 17
Amnion
Anterior Intestinal Portal
Atria
Blood Vessels
Extraembryonic
Extraembryonic Blood Vessels
Extraembryonic Mesoderm
Gut
Lateral Plate Mesoderm
Notochord
Sinus Venosus
Ventricles
extraembryonic endoderm
extraembryonic mesoderm
Dorsal view.
Ventral view.
19-24
stage 19
stage 19
stage 23
Allantois
Anterior/Second Heart Field
Gut
Heart
Leg
Pharyngeal Arches and Clefts
Somatic Mesoderm
Wing
 
25
stage 25
stage 25
Allantois
Anterior/Second Heart Field
Gut
Heart
Leg
Pharyngeal Arches and Clefts
Somatic Mesoderm
Wing
 

Entry 2

GEISHA IdHAND1.Wu.2002Data SourcePublication
Complete cDNA Template Probeshow
CCGACGGACCATGAACCTGGTGGGGGGGTACCAGCACCACCACCACCACCACCACCACCACCACATGCTGCACGAGCCC
TTCCTCTTCGGGCCGGCGGCTCGCTGCCACCAGGAGCGCGCTTATTTCCCCGGCTGGGTGCTGAACCCGGCCGAGGTGA
CCCCGGAGCTCCACGGGCAGAGCCCCGCGTACGGCCCCGCCGAGTTCGGCTCGGGAGGAGCGGGCAGGCTGGAAGCGCT
CAGCGGTCGTTTGGGGAGAAGGAAAGGGGTCGGGGGTCCCAAAAAGGAGAGGAGGAGAACGGAGAGCATCAACAGCGCT
TTCGCTGAGCTCCGCGAGTGCATCCCCAACGTGCCCGCCGACACCAAGCTGTCCAAGATCAAGACGCTGCGCCTGGCCA
CCAGCTACATCGCCTACCTGATGGAGGTGCTGGCCAGGGACAGCCAGCCCGGAGAGCCCGAGGGCTTCAAGGCCGAGCT
CAAGAAAGCCGACGGCCGCGAGAACAAGAGGAAACGGGAGACGCAGCCCGAGGTGTACTCGCAGCCTTTGGCTCACGGC
GAGAAGAAGCTGAAGGGCCGCACCGGTTGGCCCCAGCAGGTCTGGGCTCTGGAACTGAACCCCTGAGCCCCGCTCC
CitationWu X, Howard MJ. Transcripts encoding HAND genes are differentially expressed and regulated by BMP4 and GDNF in developing avian gut. Gene Expr. 2002;10(5-6):279-93.
Copyrightcopyright @ 2002 Cognizant Comm. Corp.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_204965).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
Hindgut
Midgut
 
31-44
stage 36
stage 36
stage 36
stage 36
stage 36
stage 36
stage 44
Hindgut
Midgut
 

Entry 3

GEISHA IdHAND1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
TGAGAGCCCGAGGGCTTCAAGGCCGAGCTCAAGAAAGCCGACGGCCGCGAGAACAAGAGGAAACGGGAGATGCAGCCCG
AGGTGTACTCGCAGCCTNNGGCTCACGGCGAGAAGAAGCTGAAGGGCCGCACCGGTTGGCCCCAGCAGGTCTGGGCTCT
GGAACTGAACCCCTGAGCCCCGCTCC
CommentsImages and probe sequence information provided by Claire Anderson.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Lateral Plate Mesoderm
extraembryonic mesoderm
 
7-12
stage 7
stage 8
stage 8
stage 9
stage 10
stage 12
Amnion
Anterior Intestinal Portal
Aorta
Extraembryonic Blood Vessels
Heart
Lateral Plate Mesoderm
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
HH8-, Ventral view
Ventral view
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.478

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona