GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HBM
hemoglobin subunit mu

Gene
Official SymbolHBM
Official Full Namehemoglobin subunit mu
CGNC ID50309
also known asHBA2, HBAD, hemoglobin subunit alpha-D|adult alpha D globin|alpha-D-globin|hemoglobin alpha, subunit D|hemoglobin alpha-D chain|hemoglobin, alpha 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001004375
PolypeptideNP_001004375
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2902
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish563335ENSDARG00000045144ZDB-GENE-070410-131ZFIN:ZDB-GENE-070410-131
Gene Ontology
Molecular Functionheme binding, iron ion binding, oxygen binding, oxygen transporter activity
Biological Process
Cellular Componenthemoglobin complex
Links to other databases
Entrez Gene416651
Ensembl Gene
KEGGgga:416651

Entry 1

GEISHA IdHBM.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
AGCCACCAGCCCGCCCCACCAGCTGCCACCATGCTGACTGCCGAGGACAAGAAGCTCATCCAGCAGGCCTGGGAGAAGG
CCGCTTCCCACCAGGAGGAGTTTGGAGCTGAGGCTCTGACTAGGATGTTCACCACCTATCCCCAGACCAAGACCTACTT
CCCCCACTTCGACCTTTCGCCTGGCTCTGACCAGGTCCGTGGCCATGGCAAGAAGGTGTTGGGTGCCCTGGGCAACGCC
GTGAAGAACGTGGACAACCTCAGCCAGGCCATGGCTGAGCTGAGCAACCTGCATGCCTACAACCTGCGTGTTGACCCCG
TCAATTTCAAGCTGTTGTCGCAGTGCATCCAGGTGGTGCTGGCTGTACACATGGGCAAAGACTACACCCCTGAAGTGCA
TGCTGCCTTCGACAAGTTCCTGTCTGCCGTGTCTGCTGTGCTGGCTGAGAAGTACAGATAAGCCACCATCTACAACTTC
AAGTCTTCAATAAAGACACCATTGCTGC
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST382l19. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Blood
Blood Islands
 

Entry 2

GEISHA IdHBM.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CAGCCACCAGCCCGCCCCACCAGCTGCCACCATGCTGACTGCCGAGGACAAGAAGCTCATCCAGCAGGCCTGGGAGAAG
GCCGCTTCCCACCAGGAGGAGTTTGGAGCTGAGGCTCTGACTAGGATGTTCACCACCTATCCCCAGACCAAGACCTACT
TCCCCCACTTCGACCTTTCGCCTGGCTCTGACCAGGTCCGTGGCCATGGCAAGAAGGTGTTGGGTGCCCTGGGCAACGC
CGTGAAGAACGTGGACAACCTCAGCCAGGCCATGGCTGAGCTGAGCAACCTGCATGCCTACAACCTGCGTGTTGACCCC
GTCAATTTCAAGCTGTTGTCGCAGTGCATCCAGGTGGTGCTGGCTGTACACATGGGCAAAGACTACACCCCTGAAGTGC
ATGCTGCCTTCGACAAGTTCCTGTCTGCCGTGTCTGCTGTGCTGGCTGAGAAGTACAGATAAGCCACCATCTACAACTT
CAAGTCTTCAATAAAGACACCATTGCTGAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2902

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070410-131
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona