GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HOXA2
homeobox A2

Gene
Official SymbolHOXA2
Official Full Namehomeobox A2
CGNC ID49629
also known ashomeobox protein Hox-A2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205150
PolypeptideNP_990481
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.524
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processanterior/posterior pattern specification, brain segmentation, cell fate determination, more...dorsal/ventral pattern formation, embryonic viscerocranium morphogenesis, middle ear morphogenesis, motor neuron axon guidance, negative regulation of neuron differentiation, negative regulation of transcription from RNA polymerase II promoter, osteoblast development, positive regulation of transcription from RNA polymerase II promoter, rhombomere 2 development, rhombomere 3 morphogenesis, segment specification, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene396055
Ensembl GeneENSGALG00000011053
KEGGgga:396055

Entry 1

GEISHA IdHOXA1.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
ATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTGAGTGCCTGACATCTTTTCCCC
CTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGACACTGATTCCTCCTCCTTTCGA
GCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGCCCCAAGGCGAGCCCCCGCGCC
CGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGAAAGAGAAAAAGGCGTCCAAGC
GATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAGCCACAAAGCCCCGGCTGAAGC
GGGGAAGCCCGGAGAAGGTGCGGGGGGAGAGGGGACCGTCCGGACCAACTTCACCACCAAGCAGCTCACCGAGCTGGAG
AAGGAGTTCCACTTCAACAAGTACCTGACCCGGGCCAGGCGGGTGGAAATCGCCGCCTCCCTCCAGCTCAACGAGACGC
AGGTGAAGATCTGGTTCCAGAACCGGCGGATGAAGCAGAAGAAGAGGGAGAAAGAGGGGCTGCTGCCCATCTCCCCCGC
CACCCCCACGGGCTGCGAGGAGAAGGCGGACGACCCGTCGGAGAAGTGCTGCCCGTCGCCCTGCAGCGCCTCTCCCGCA
TCCTGCGCCTCGGACCCGGGACCCGCCGCCAACTGAGCTCCCCCGAGCCGCGGTGCGCTCCGTCGGTCCGTCCCGTCGG
TCGGGCCCGGGGGCGCCGGCCCGGCCGCTCCCGGCCCCTGCCGCCAAGAGGTTTTCTTTCGGTCCCCCCCTCCTCACCT
CCTTGCCGGAGGAGTCGCGTTGGCACGCGCGTGGGTTCTCCCTCCTCCCCGCAAGGACGTTCCTCTGAGTTTCCCTGGG
TGACAGACAGGTCACGGAGGGTACATAACCTCACGAAGAGATGCACTATGGCAAGTGTTTACACGACTTCTAGGACTTT
CATCCTTTAATTTAATGTATACTTTGTTCGTGTCTATGAGTTCGTTGCTTGTAAATACTTTGTCCGAGAGATTTATCTT
TTTACAGATTTTTTCTAGAGATGACGTTTAGATGATCAGGTGAAGCAGGGTGAGTGCATTCGCCAAACCGGACCCACTT
TTCGATCGGTCAGGGCTGACGGCAGCATCAAGCAGACGTGTTAAGCTCCAGCAGATACCTCAAAGCGTAGCGCTATTTC
CCAAAACGTGACAAACAAGGCTTCAATTGCACTAGGTTTTGTAAACCTTACCCCGTGTGCTGTCCCCCCCCTCCCCCAT
TCAGCTGTGCTGGGCTGTGCCGGACAGAGGGACACCGCCGCCCCACGGACCTCACCTCTCCCCGTTTCCGTACTCCCCC
TCCTTTAGCCTCGATGTCTTTTCGACCCGCTCGTGAATGTGTCGGATGGCCAAATGAATGTATAACTTCTGTGGTTGGT
GTCCGGGCCGCTGCATGCCGCCCCGTGTGTGCTGTACTCGGGACACGGAGCTCTGTCGGGCGGGAG
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # XM_001234919).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
stage 6
Neural Plate/Tube
Primitive Streak
 
7-9
stage 8
stage 9
Ear/Otic Placode
Neural Plate/Tube
Primitive Streak
Somites
 

Entry 2

GEISHA IdHOXA2.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
TCTTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGC
GGGGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTG
AGTGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGAC
ACTGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGC
CCCAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGA
AAGAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAG
CCACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAG
CTCTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGG
ATCTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAA
CCAGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTC
TTCGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGC
AGCAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCT
GAAACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAAC
AATGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTT
CAGACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTAC
AGACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205150.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
stage 6
Ear/Otic Placode
Ectoderm
Endoderm
Kohler's Sickle
Mesoderm
Primitive Streak
 
7-9
stage 8
stage 9
Ear/Otic Placode
Endoderm
Hindbrain
Mesoderm
Neural Plate/Tube
Primitive Streak
Somites
 

Entry 3

GEISHA IdHOXA2.Tossell.2011Data SourcePublication
Complete cDNA Template Probeshow
TCTTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGC
GGGGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTG
AGTGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGAC
ACTGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGC
CCCAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGA
AAGAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAG
CCACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAG
CTCTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGG
ATCTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAA
CCAGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTC
TTCGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGC
AGCAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCT
GAAACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAAC
AATGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTT
CAGACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTAC
AGACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationTossell K, Kiecker C, Wizenmann A, Lang E, Irving C. Notch signalling stabilises boundary formation at the midbrain-hindbrain organiser. Development. 2011 Sep;138(17):3745-57. Epub 2011 Jul 27.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205150.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
stage 10
stage 10
Isthmus/MHB
Rhombomeres
GFP control embryo
double in situ: Fgf8 (red) and Hoxa2 (blue)

Entry 4

GEISHA IdHOXA2.Lorente-Cánovas.2012Data SourcePublication
Complete cDNA Template Probeshow
TCTTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGC
GGGGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTG
AGTGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGAC
ACTGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGC
CCCAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGA
AAGAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAG
CCACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAG
CTCTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGG
ATCTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAA
CCAGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTC
TTCGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGC
AGCAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCT
GAAACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAAC
AATGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTT
CAGACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTAC
AGACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationLorente-Cánovas B, Marín F, Corral-San-Miguel R, Hidalgo-Sánchez M, Ferrán JL, Puelles L, Aroca P. Multiple origins, migratory paths and molecular profiles of cells populating the avian interpeduncular nucleus. Dev Biol. 2012 Jan 1;361(1):12-26.
CopyrightCopyright © 2011 Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205150.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
stage 26
stage 26
Rhombomeres
HOXA2 (blue)
PAX7 (brown)
31-38
stage 38
Isthmus/MHB
Rhombomeres
HOXA2 (blue)
PAX7 (brown)

Entry 5

GEISHA IdHOXA2.Giudicelli.2001Data SourcePublication
Complete cDNA Template Probeshow
TCTTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGC
GGGGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTG
AGTGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGAC
ACTGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGC
CCCAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGA
AAGAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAG
CCACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAG
CTCTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGG
ATCTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAA
CCAGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTC
TTCGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGC
AGCAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCT
GAAACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAAC
AATGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTT
CAGACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTAC
AGACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationGiudicelli F, Taillebourg E, Charnay P, Gilardi-Hebenstreit P. Krox-20 patterns the hindbrain through both cell-autonomous and non cell-autonomous mechanisms. Genes Dev. 2001 March 1; 15(5): 567–580.
CopyrightCopyright © 2001, Cold Spring Harbor Laboratory Press
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205150.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
Rhombomeres
 

Entry 6

GEISHA IdHOXA2.Richardson.2011Data SourcePublication
Complete cDNA Template Probeshow
TTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGCGG
GGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTGAG
TGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGACAC
TGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGCCC
CAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGAAA
GAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAGCC
ACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAGCT
CTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGGAT
CTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAACC
AGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTCTT
CGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGCAG
CAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCTGA
AACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAACAA
TGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTTCA
GACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTACAG
ACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationRichardson J, Shono T, Okabe M and Graham A. The presence of an embryonic opercular flap in amniotes. PLoS One. 2012; 7(9): e44903. Published online 2012 September 11.
CopyrightPLoS One. 2012; 7(9): e44903. Published online 2012 September 11.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205150.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-26
stage 26
stage 26
Pharyngeal Arches and Clefts
 

Entry 7

GEISHA IdHoxA2.Martinez.2018Data SourcePublication
Complete cDNA Template Probeshow
TTTTTTTCTCCTCTCTCTCCTTTTTCCCGGGCCTTCCCCCCCCGAGCCCCCGGCATCCGGGGGAACTTTTTCTCCGCGG
GGGCTGCGAGTTGAAGGCCATGAATTTCGAATTCGAGCGAGAGATCGGTTTTATCAATAGTCAGCCATCGCTTGCTGAG
TGCCTGACATCTTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAACTCGACGCTTTCACACTCGACAC
TGATTCCTCCTCCTTTCGAGCAGACCATCCCCAGCCTGAACCCCGGCGGCCACCCTCGCCACAGCGGCGGCGGCCGCCC
CAAGGCGAGCCCCCGCGCCCGCAGCGGCAGCCCGGGCCCCGCCGGCGCCCCGCCGCCCCCGGAGTACCCCTGGATGAAA
GAGAAAAAGGCGTCCAAGCGATCCTCGCTGCCGCCCGCCTCGGCCTCCGCCTCAGCCGCCGGACCCGCCTGCCTCAGCC
ACAAAGACCCCCTTGAAATCCCCGATAGTGGCAGCGGTGGATCTAGGCGGCTGAGGACGGCCTACACCAACACGCAGCT
CTTGGAGCTGGAGAAAGAATTCCACTTCAACAAGTACCTCTGCAGACCGCGCCGGGTCGAGATCGCAGCGCTGCTGGAT
CTGACCGAGAGGCAAGTGAAGGTCTGGTTCCAGAACCGCAGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAACC
AGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCGAGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTCTT
CGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGAGAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGCAG
CAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGTTTCCCCGTTTCGCCTTTAACGAGCAATGAGAAAAATCTGA
AACATTTTCAACACCAGTCACCCACTGTTCAAAACTGCCTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAACAA
TGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGGACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTTCA
GACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAGCCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTACAG
ACACGCTCACCACGATTGACTTACAGCATCTGAATTACTGAGAAATTAAAGACGTCCTCTCCCAGGGAAAAAAA
CitationMartinez D, Zuhdi N, Reyes M, Ortega B, Giovannone D, Lee VM, de Bellard ME. Screen for Slit/Robo signaling in trunk neural cells reveals new players. Gene Expr Patterns. 2018 Jun;28:22-33. Epub 2018 Feb 7. DIO: 10.1016/j.gep.2018.01.002.
CopyrightCopyright © 2018 The Authors. Published by Elsevier B.V.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_205150)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
Neural Plate/Tube
Somites
 
13-18
stage 13
stage 16
Neural Crest
Neural Plate/Tube
Rhombomeres
Somites
 
19
stage 19
Neural Crest
Neural Plate/Tube
Somites
 
all
 
  

Entry 8

GEISHA IdHOXA2.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GGAGAGGACGTCTTTAATTTCTCAGTAATTCAGATGCTGTAAGTCAATCGTGGTGAGCGTGTCTGTAAAAAAGTCAAAG
CTGTCAGCGGAGATATCTACGGGGCTGTCCAGAGAGCCCGGCAAACTGGGGGAAACCGCGTCTGAAAGCTGCAGGCAGG
AATCTGTGGAGAAAACGTTAAAGTCCTGTAAAGAGGGGACCTCGAGGGCCTCAGGACTGTCATTGTTGAGGCCAGCTGC
GCAGTTCTGGGCCATTGTTGAGAGGCAGTTTTGAACAGTGGGTGACTGGTGTTGAAAATGTTTCAGATTTTTCTCATTG
CTCGTTAAAGGCGAAACGGGGAAACTTTGGGATTCGCCATTGTGCGCATTCTGCGCCTGCTGCTGCGAGAGCGCATTCT
GCTGAAACGCGTAGCCCTCCCTCTCCAGCAGCGCTCCCGAGACGGTGCCCAGGGCTTGCTCGAAGAGGGCTTTCTCCTC
CTCGTCGTCCTCCGCCGCCTTCTCGGGGTCCTCCGAGCCCTTAAATTTCCCCTCGCCGTTCTGGTTCTCCTTGCACTGG
GTCTGCCTCTTGTGCTTCATCCT
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST671c8. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Dermomyotome
Ectoderm
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Notochord
Pharynx
Rhombomeres
Sclerotome
Somatic Mesoderm
Somites
Splanchnic Mesoderm
extraembryonic mesoderm
section 16
section 20
section 3
section 48
section 58

Entry 9

GEISHA IdHOXA2.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
AGGATGAAGCACAAGAGGCAGACCCAGTGCAAGGAGAACCAGAACGGCGAGGGGAAATTTAAGGGCTCGGAGGACCCCG
AGAAGGCGGCGGAGGACGACGAGGAGGAGAAAGCCCTCTTCGAGCAAGCCCTGGGCACCGTCTCGGGAGCGCTGCTGGA
GAGGGAGGGCTACGCGTTTCAGCAGAATGCGCTCTCGCAGCAGCAGGCGCAGAATGCGCACAATGGCGAATCCCAAAGT
TTCCCCGTTTCGCCTTTAACGAGCAATGAGAACAAATCTGAAACATTTTCAACACCAGTCACCCACTGTTCAAAACTGC
CTCTCAACAATGGCCCAGAACTGCGCAGCTGGCCTCAACAATGACAGTCCTGAGGCCCTCGAGGTCCCCTCTTTACAGG
ACTTTAACGTTTTCTCCACAGATTCCTGCCTGCAGCTTTCAGACGCGGTTTCCCCCAGTTTGCCGGGCTCTCTGGACAG
CCCCGTAGATATCTCCGCTGACAGCTTTGACTTTTTTACAGACACGCTCACCACGATTGACTTACAGCATCTGAATTAC
TGAGAAATTAAAGACGTCCTCTCCAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.524

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona