GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HOXB1
homeobox B1

Gene
Official SymbolHOXB1
Official Full Namehomeobox B1
CGNC ID10116
also known asGhox-lab, HOXB-1, homeobox protein Hox-B1|homeobox-containing transcription factor Hoxb-1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001080859
PolypeptideNP_001074328
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.533
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human3211MIM:142968
Mouse15407ENSMUSG00000018973All phenotypic alleles (16):Targeted, knock-out(2) Targeted, other(14) MGI:96182
Xenopus100493290, 100301962485771
Zebrafish30337, 30374ENSDARG00000008174ZDB-GENE-990415-101, ZDB-GENE-980526-290ZFIN:ZDB-GENE-990415-101, ZFIN:ZDB-GENE-980526-290
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processmulticellular organismal development, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene395900
Ensembl GeneENSGALG00000013454
KEGGgga:395900

Entry 1

GEISHA IdW24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCCGGGGTTTACGGCAACCTCTCGCCTTCCCTAAATG
AGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCGCGGCGCGGACCTTCGATTGGATGAAAGTGAA
GAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCTGGGACAGCCCAACACCATTCGCACCAACTTCACC
ACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAGTACCTCACCCGGGCCCGGAGGGTGGAGATCGCCG
CTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGAACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGA
AGGTCTTGCTCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAGTGAAGCCTCGGATCAGTCCAACTGCACCTCACCT
GATGCCTCCCCCAACTCCGTGTCCTCCTGAGCCGCGGTCCCGCGGGGCACAACGACCGGATCGGGGCTGCCTTCGAAGG
CCGCTGCATCCCCG
Reverse cDNA Template Probeshow
GCCATTTTGCACTATCGTCGCTTTACAGGGTTTCCTACACGCTCTCCGCCTGTATTACCGATCCTGGGGGTGGGAGCGT
TGTGCTATCAGATAAAACGAGATAAGGGGAAGGCTGAGCCCGGGGTGCTTTGGGCAACGGTCATTGCCGCACCGAGTGT
GAACGTGCACGGGACGAAGGCCGGGGGGGTCCGCACTGCGCTCCCCCAACCGCGATGCACTGACTGCTATTTATTGTAC
GTCTCGATAGCCTCACGTCTTGGGGCGAAGCTGCACGGCTCCTCGTATCCCCACCCCCTCAGGCTTATCGGAGTCCGAG
AAAAACATAATTAACCACGGCCAGTTGCTACCCTTTACCACCAGAAGCTTTAGCGCAGGGCGAAGTGAAAACCACGGCG
AGTTTCGTTAAAGGTTGTTTTAAAGAGATAAAGGGTCATCCTGAAAAGCCTGTGGTTTCTTAATCGGAATCTGTTTTCC
CTCTACTCCCTTCCCTGTTTTTCGAAATGAAACTACCTCAGTCTAATAAAGTTTACTTTTTCCAAAAAAAAAAAAAAAA
AA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 4
stage 6
stage 6
Epiblast
Primitive Streak
Surface Ectoderm
 
13-18
stage 13
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
 
19
stage 19
stage 19
Hindbrain
Rhombomeres
Spinal Cord
Trunk Mesenchyme
 

Entry 2

GEISHA IdHoxb-1.Reijntjes.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGGCGTACGGTGCGGG
GGGCAGCCCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCGCCTCCGGGCGCTCCGTCCCTT
CGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAACTGCAGCCCCGGCTACGGCACCACCAGCTCTACCTCGGCC
AGCAGGACGCGGACGCGGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGCAGA
GGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCAGCTACTTGCCCGGG
GTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCC
GGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCTGGG
ACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAGTAC
CTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGAACA
GGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAGTGA
AGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationReijntjes S, Gale E, Maden M. Generating gradients of retinoic acid in the chick embryo: Cyp26C1 expression and a comparative analysis of the Cyp26 enzymes. Dev Dyn. 2004 Jul;230(3):509-17.
CopyrightWiley-Liss, Inc. 2004
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Hindbrain
Neural Plate/Tube
Spinal Cord
 
7-9
stage 9
stage 9
Hindbrain
Neural Plate/Tube
Spinal Cord
 

Entry 3

GEISHA IdHOXB1.Bok.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGGCGTACGGTGCGGG
GGGCAGCCCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCGCCTCCGGGCGCTCCGTCCCTT
CGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAACTGCAGCCCCGGCTACGGCACCACCAGCTCTACCTCGGCC
AGCAGGACGCGGACGCGGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGCAGA
GGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCAGCTACTTGCCCGGG
GTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCC
GGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCTGGG
ACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAGTAC
CTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGAACA
GGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAGTGA
AGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationBok J, Bronner-Fraser M, Wu DK. Role of the hindbrain in dorsoventral but not anteroposterior axial specification of the inner ear. Development. 2005 May;132(9):2115-24. Epub 2005 Mar 23.
CopyrightCopyright for articles in Development are retained by the authors. Permission granted by MBF.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001080859).
no images

Entry 4

GEISHA IdHOXB1.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGGCGTACGGTGCGGG
GGGCAGCCCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCGCCTCCGGGCGCTCCGTCCCTT
CGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAACTGCAGCCCCGGCTACGGCACCACCAGCTCTACCTCGGCC
AGCAGGACGCGGACGCGGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGCAGA
GGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCAGCTACTTGCCCGGG
GTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCC
GGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCTGGG
ACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAGTAC
CTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGAACA
GGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAGTGA
AGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_001080859.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
stage 6
stage 6
Mesoderm
Primitive Streak
 
7-11
stage 9
stage 11
Ear/Otic Placode
Endoderm
Mesoderm
Neural Plate/Tube
Primitive Streak
Somites
 

Entry 5

GEISHA IdHOXB1.Alev.2010Data SourcePublication
Complete cDNA Template Probeshow
CCTCGAGACGGCTAAAACAGAAAAGTTTGGGGTGCTTTTTTTTTGTTTCCCTTTTACATTTACTCTGTGTATCTCGGAA
AGAGCCCAAGGCGCTGAAGGCCTCTGGGAAGACCCGAAAAAGAAAAGAAACGAAGCAAAAACGCAACTCCTCTGCTGCC
ATTTTGCACTATCGTCGCTTTACAGGGTTTCCTACACGCTCTCCGCCTGTATTACCGATCCTGGGGGTGGGAGCGTTGT
CCTATCAGATAAAACGAGATAAGGGGAAGGCTGAGCCGGGGTGCTTGGGCAACGGTCATTGCCGCACCGAGTGTGAACG
TGCATGGGACGAAGGCGGGGGGGTCCGCACTGGCCTCCCCCAACCGCGATGCACTGACTGCTATTTATTGTACGTCTCG
ATAGCCTCACTTCTTGGGGCGAACTGGCACGGCTCCTCGTATCCCCACCCCCTCAGGCTTATCGGAGTCGAGAAAAACA
TAATAGGCACGGCCAGTTGCTACCCTTTACCACCAGAAGCTTTAGCGCAGGGCGAAGTGAAAACCACGGCGAGTTTCGT
TAAAGGTTGTTTTAAAGAGATAAAGGGTCATCCTGAAAAGCCTGTGGT
CitationAlev C, Wu Y, Kasukawa T, Jakt LM, Ueda HR, Sheng G. Transcriptomic landscape of the primitive streak. Development. 2010 Sep 1;137(17):2863-74. Epub 2010 Jul 28.
CopyrightPublished by The Company of Biologists 2010. This material is protected by a copyright retained by the authors. Permission granted by Dr. G Sheng.
CommentsFORWARD PRIMER CCTCGAGACGGCTAAAACAG REVERSE PRIMER ACCACAGGCTTTTCAGGATG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Early Mesoderm
Primitive Streak
 

Entry 6

GEISHA IdHOXB1.Bothe.2011Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGCGCTACGGTGCGGG
GGGCAGCGCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCCGCCTCCGGGCGCTCCGTGCCC
TTCGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAATTGCAGCCCCGGCTACGGGCACCACCAGCTCTACCTCG
GCCAGCAGGACGCGGACGGCGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGC
AGAGGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCC
GGGGTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCA
GCGCGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCT
GGGACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAG
TACCTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGA
ACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAG
TGAAGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationBothe I, Tenin G, Oseni A, Dietrich S., Dynamic control of head mesoderm patterning., Development. 2011 Jul;138(13):2807-21.
CopyrightPermission from the authors and the Company of Biologists Ltd. Copyright held by the authors.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #XM_003642793.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Early Endoderm
Early Mesoderm
Epiblast
Hensen's Node
Primitive Streak
 
7-12
stage 7
stage 10
Neural Plate/Tube
Rhombomeres
Sinus Venosus
Spinal Cord
 
13
stage 13
stage 13
Rhombomeres
Spinal Cord
Trunk Mesenchyme
 

Entry 7

GEISHA IdHOXB1.Chambers.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGCGCTACGGTGCGGG
GGGCAGCGCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCCGCCTCCGGGCGCTCCGTGCCC
TTCGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAATTGCAGCCCCGGCTACGGGCACCACCAGCTCTACCTCG
GCCAGCAGGACGCGGACGGCGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGC
AGAGGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCC
GGGGTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCA
GCGCGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCT
GGGACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAG
TACCTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGA
ACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAG
TGAAGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationChambers D, Wilson L, Maden M, Lumsden A. RALDH-independent generation of retinoic acid during vertebrate embryogenesis by CYP1B1. Development. 2007 Apr;134(7):1369-83.
Copyright© 2007
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # XM_003642793.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
stage 17
stage 17
Hindbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Rhombomeres
 

Entry 8

GEISHA IdHOXB1.Garcia-Dominguez.200Data SourcePublication
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGCGCTACGGTGCGGG
GGGCAGCGCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCCGCCTCCGGGCGCTCCGTGCCC
TTCGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAATTGCAGCCCCGGCTACGGGCACCACCAGCTCTACCTCG
GCCAGCAGGACGCGGACGGCGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGC
AGAGGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCC
GGGGTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCA
GCGCGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCT
GGGACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAG
TACCTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGA
ACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAG
TGAAGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGA
CitationGarcia-Dominguez M, Poquet C, Garel S, Charnay P. PIASxβ acts as an activator of Hoxb1 and is antagonized by Krox20 during hindbrain segmentation. EMBO J. 2006 June 7; 25(11): 2432–2442. Published online 2006 May 4.
CopyrightCopyright © 2006, European Molecular Biology Organization
CommentsFig4C
no images

Entry 9

GEISHA IdGHOXLAB.Bell.2004Data SourcePublication
Forward cDNA Template Probeshow
GAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCCGGGGTTTACGGCAACCTCTCGCCTTCCCTAAATG
AGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCGCGGCGCGGACCTTCGATTGGATGAAAGTGAA
GAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCTGGGACAGCCCAACACCATTCGCACCAACTTCACC
ACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAGTACCTCACCCGGGCCCGGAGGGTGGAGATCGCCG
CTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGAACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGA
AGGTCTTGCTCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAGTGAAGCCTCGGATCAGTCCAACTGCACCTCACCT
GATGCCTCCCCCAACTCCGTGTCCTCCTGAGCCGCGGTCCCGCGGGGCACAACGACCGGATCGGGGCTGCCTTCGAAGG
CCGCTGCATCCCCG
Reverse cDNA Template Probeshow
GCCATTTTGCACTATCGTCGCTTTACAGGGTTTCCTACACGCTCTCCGCCTGTATTACCGATCCTGGGGGTGGGAGCGT
TGTGCTATCAGATAAAACGAGATAAGGGGAAGGCTGAGCCCGGGGTGCTTTGGGCAACGGTCATTGCCGCACCGAGTGT
GAACGTGCACGGGACGAAGGCCGGGGGGGTCCGCACTGCGCTCCCCCAACCGCGATGCACTGACTGCTATTTATTGTAC
GTCTCGATAGCCTCACGTCTTGGGGCGAAGCTGCACGGCTCCTCGTATCCCCACCCCCTCAGGCTTATCGGAGTCCGAG
AAAAACATAATTAACCACGGCCAGTTGCTACCCTTTACCACCAGAAGCTTTAGCGCAGGGCGAAGTGAAAACCACGGCG
AGTTTCGTTAAAGGTTGTTTTAAAGAGATAAAGGGTCATCCTGAAAAGCCTGTGGTTTCTTAATCGGAATCTGTTTTCC
CTCTACTCCCTTCCCTGTTTTTCGAAATGAAACTACCTCAGTCTAATAAAGTTTACTTTTTCCAAAAAAAAAAAAAAAA
AA
CitationBell GW, Yatskievych TA, Antin PB. GEISHA, a whole-mount in situ hybridization gene expression screen in chicken embryos. Dev Dyn. 2004 Mar;229(3):677-87.
CopyrightCopyright © 2004 Wiley-Liss, Inc.
CommentsThe probe sequence below was obtained from the GEISHA database using information provided in the publication, Geisha W24.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Primitive Streak
 

Entry 10

GEISHA IdHoxb‐1.Gaunt.1996Data SourcePublication
Complete cDNA Template Probeshow
TAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCAGCTACTTGCCCGGGGTTTACGGCAACCTCTC
GCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCAGCCGGGCGCGGACCTTCGAT
TGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGGTGAGTTT
CitationGaunt SJ, Strachan L. Temporal colinearity in expression of anterior Hox genes in developing chick embryos. Dev Dyn. 1996 Nov;207(3):270-80.
CopyrightCopyright © 1996 Wiley‐Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Gaunt et al. 1996.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
Primitive Streak
 
7-12
stage 7
stage 7
stage 8
stage 8
Headfold
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
 
31-44
stage 44
stage 44
stage 44
  

Entry 11

GEISHA IdHoxb1.Iimura.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGCGCTACGGTGCGGG
GGGCAGCGCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCCGCCTCCGGGCGCTCCGTGCCC
TTCGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAATTGCAGCCCCGGCTACGGGCACCACCAGCTCTACCTCG
GCCAGCAGGACGCGGACGGCGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGC
AGAGGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCC
GGGGTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCA
GCGCGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCT
GGGACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAG
TACCTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGA
ACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAG
TGAAGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGAGCCGCGGTCCCGCGG
GGCACAACGACCGGATCGGGGCTGCCTTCGAGGGCCGCTGCTCCCCGCCGCTCCCCGCAGCCCGACCCGCACTGCCCCG
CACAGCCCCGGCCGCACACGCTTCCCTCCGAGCCGCCCCTTCGGCTCCGGCCGCCTCCACGCGTGCGGTGCCCATTCCC
CGTTTGCCTTCCTCTCTTAATTTATAGACCCTCCGTCAAACGTTGGACTCCAAAGGAGCGGCCGTGTCCTCGTTTATCC
TTAGCAATAGGCGTTTGTCTCAGGGACGTTTCTCCCTTCTCCCCTCCCCCGATAGGAACTGCACTTTCAACTACAGAAA
CTTGAAAACGAATTTAGTTCTCTCCCGCTTTAAAGATGTGCACAACGACTTTTGTCCGCACGCACCCTGAGTTTGCTGT
GTTATTCCTCCCCTCGAGACGGCTAAAACAGAAAAGTTTGGGGTGCTTTTTTTTGTTTCCCTTTTACATTTACTCTGTG
TATCTCGGAAAGAGCCCAAGGCGCTGAAGGCCTCTGGGAAGACCCGAAAAAGAAAAGAAACGAAGCAAAAACGCAACTC
CTCTGCTGCCATTTTGCACTATCGTCGCTTTACAGGGTTTCCTACACGCTCTCCGCCTGTATTACCGATCCTGGGGGTG
GGAGCGTTGTGCTATCAGATAAAACGAGATAAGGGGAAGGCTGAGCCCGGGGTGCTTTGGGCAACGGTCATTGCCGCAC
CGAGTGTGAACGTGCATGGGACGAAGGCCGGGGGGGTCCGCACTGCGCTCCCCCAACCGCGATGCACTGACTGCTATTT
ATTGTACGTCTCGATAGCCTCACTTCTTGGGGCGAAGCTGCACGGCTCCTCGTATCCCCACCCCCTCAGGCTTATCGGA
GTCCGAGAAAAACATAATTAACCACGGCCAGTTGCTACCCTTTACCACCAGAAGCTTTAGCGCAGGGCGAAGTGAAAAC
CACGGCGAGTTTCGTTAAAGGTTGTTTTAAAGAGATAAAGGGTCATCCTGAAAAGCCTGTGGTTTCTTAATCGGAATCT
GTTTTCCCTCTACTCCCTTCCCTGTTTTTCGAAATGAAACTACCTCAGTCTAATAAAGTTTACTTTTTCCA
CitationTadahiro Iimura, Olivier Pourquié. Collinear activation of Hoxb genes during gastrulation is linked to mesoderm cell ingression. Nature. 2006 Aug 3;442(7102):568-71. Epub 2006 Jun 7. DOI: 10.1038/nature04838.
CopyrightCopyright © 2006 Nature Publishing Group.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_001080859.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
HH3+
4-5
stage 4
stage 5
Early Mesoderm
Primitive Streak
 

Entry 12

GEISHA IdHoxb1.Bel-Vialar.2002Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGGACAATACTAGGATGAACTCCTTCTTAGAGTATGCAATTTGTAACCGTGGGACGGGCGCCTACCACCATTTAGAGC
AAAGCTCCCCTTCCTTCCCCTCTTGCTCAGGTAGCCCCTCCAGTGACACTTTTCATGGAGAAGGGCGCTACGGTGCGGG
GGGCAGCGCGGTCGCGGCCGCCCATCTCCCCCCGCAGAGCCCCGGCTTCTTCCCCGCCGCCTCCGGGCGCTCCGTGCCC
TTCGCGGCCGCTGCCCCGAGCGCCGGGTACCCAACCCAAAATTGCAGCCCCGGCTACGGGCACCACCAGCTCTACCTCG
GCCAGCAGGACGCGGACGGCGTGTACTTCCAGGCGGCCGGGTACTCCTCCAGCACCGGACCCCACCTCGGCTCCCTGGC
AGAGGGCTATTGTGGGGCCGTAGGGCAGTACCAGCAGCAGCAGCACCTTTACGGGCAGGAGCAGCCCGGTTACTTGCCC
GGGGTTTACGGCAACCTCTCGCCTTCCCTAAATGAGGACAAAGACCCCGCGTGCCCCTCCGAGCCGTGCCCCAATGCCA
GCGCGGCGCGGACCTTCGATTGGATGAAAGTGAAGAGGAACCCCCCCAAGACAGCCAAAGTGTCGGAATACGGGCTGCT
GGGACAGCCCAACACCATTCGCACCAACTTCACCACCAAGCAGCTGACGGAGCTGGAGAAGGAGTTTCACTTTAACAAG
TACCTCACCCGGGCCCGGAGGGTGGAGATCGCCGCTACACTGGAGCTCAACGAAACCCAAGTCAAGATCTGGTTCCAGA
ACAGGCGGATGAAACAGAAGAAGAGGGAAAAGGAAGGTCTCGCCCCTCCTGCTGCCTCCAGGTCCGCGAAGGAAGCGAG
TGAAGCCTCGGATCAGTCCAACTGCACCTCACCTGAGGCCTCCCCCAGCTCCGTGTCCTCCTGAGCCGCGGTCCCGCGG
GGCACAACGACCGGATCGGGGCTGCCTTCGAGGGCCGCTGCTCCCCGCCGCTCCCCGCAGCCCGACCCGCACTGCCCCG
CACAGCCCCGGCCGCACACGCTTCCCTCCGAGCCGCCCCTTCGGCTCCGGCCGCCTCCACGCGTGCGGTGCCCATTCCC
CGTTTGCCTTCCTCTCTTAATTTATAGACCCTCCGTCAAACGTTGGACTCCAAAGGAGCGGCCGTGTCCTCGTTTATCC
TTAGCAATAGGCGTTTGTCTCAGGGACGTTTCTCCCTTCTCCCCTCCCCCGATAGGAACTGCACTTTCAACTACAGAAA
CTTGAAAACGAATTTAGTTCTCTCCCGCTTTAAAGATGTGCACAACGACTTTTGTCCGCACGCACCCTGAGTTTGCTGT
GTTATTCCTCCCCTCGAGACGGCTAAAACAGAAAAGTTTGGGGTGCTTTTTTTTGTTTCCCTTTTACATTTACTCTGTG
TATCTCGGAAAGAGCCCAAGGCGCTGAAGGCCTCTGGGAAGACCCGAAAAAGAAAAGAAACGAAGCAAAAACGCAACTC
CTCTGCTGCCATTTTGCACTATCGTCGCTTTACAGGGTTTCCTACACGCTCTCCGCCTGTATTACCGATCCTGGGGGTG
GGAGCGTTGTGCTATCAGATAAAACGAGATAAGGGGAAGGCTGAGCCCGGGGTGCTTTGGGCAACGGTCATTGCCGCAC
CGAGTGTGAACGTGCATGGGACGAAGGCCGGGGGGGTCCGCACTGCGCTCCCCCAACCGCGATGCACTGACTGCTATTT
ATTGTACGTCTCGATAGCCTCACTTCTTGGGGCGAAGCTGCACGGCTCCTCGTATCCCCACCCCCTCAGGCTTATCGGA
GTCCGAGAAAAACATAATTAACCACGGCCAGTTGCTACCCTTTACCACCAGAAGCTTTAGCGCAGGGCGAAGTGAAAAC
CACGGCGAGTTTCGTTAAAGGTTGTTTTAAAGAGATAAAGGGTCATCCTGAAAAGCCTGTGGTTTCTTAATCGGAATCT
GTTTTCCCTCTACTCCCTTCCCTGTTTTTCGAAATGAAACTACCTCAGTCTAATAAAGTTTACTTTTTCCA
CitationSophie Bel-Vialar, Nobue Itasaki, Robb Krumlauf. Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 2002 Nov;129(22):5103-15.
CopyrightCopyright © The Company of Biologists Limited 2002.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_001080859.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
Intermediate Mesoderm
Lateral Plate Mesoderm
Rhombomeres
Spinal Cord
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.533

Mouse

EmageMGI:96182
EurexpressMGI:96182
MGI GXDMGI:96182

Frog

Xenbase485771

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990415-101, ZDB-GENE-980526-290
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona