GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HOXB5
homeobox B5

Gene
Official SymbolHOXB5
Official Full Namehomeobox B5
CGNC ID52343
also known asGhox-2.1, Hoxb-5, homeobox protein Hox-B5|homeo box B5|homeobox protein Hox-2.1, Homeobox protein Hox-B5, Ghox-2.1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001025355
PolypeptideNP_001020526
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.22931
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly40833FBgn0003339
Human3215ENSG00000120075MIM:142960
Mouse15413All phenotypic alleles (2):Targeted, knock-out(1) Targeted, other(1) MGI:96186
Xenopus100113366, 3785781005990
Zebrafish30317, 58052ENSDARG00000013057, ENSDARG00000054030ZDB-GENE-980526-70, ZDB-GENE-000823-6ZFIN:ZDB-GENE-980526-70, ZFIN:ZDB-GENE-000823-6
Gene Ontology
Molecular FunctionRNA polymerase II distal enhancer sequence-specific DNA binding, more...RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription
Biological Processanterior/posterior pattern specification, embryonic skeletal system morphogenesis, more...endothelial cell differentiation
Cellular Componentnucleus
Links to other databases
Entrez Gene425096
Ensembl GeneENSGALG00000027903
KEGGgga:425096

Entry 1

GEISHA IdHOXB5.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerATAAGCAGCAGCATCCCCCG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGCAGAGAAAAACTCACCCCCAAAGcDNA Template Length822
Forward cDNA Template Probeshow
NNNNNAGGACATCTCAGCAGTAACTCAGGAAGGGGAAAAGCAACAAATAAACAAACAATCGTTATCTGTTACCATCTCA
TAAATAAGTTATAACATTTATAGGGCTCACATAAAACATGCTGGCTTTCCAGAAAGCATCAAGATAGCACGGACACGTA
CATTTATAAGAACAACGAGAGCATGGGGAGCATCTGGAAATAAAATTTAATAATAATTAAAAAAAATTATTGGGAAAAA
AATTTTATATCTCCCCCCAAAAAAGAAAAACCCCCCACGTGAACCCTCCCCGGGGAAAAGGGTCCCACACGCCTGGGTT
TCAAATAACCACCACGTCCCAAAAAAAGGGGGCCTCAGTGTACAGTACCCCAAAACAAAAATCCGGTGCGCTTTATTTT
TTTAGGGATTTATTAAATGTTCCCTCCTCTTTCCCCGATATTCCCCCCCCTAAAATTTAGGGGAAAAAGGCTCCCCCCA
CAAAACCAAACCACACGCTTTACCGTTTAATACCCCTCCCCCATTTCCCCCCCCTGTTCGGGAACCAAATTTTGATCCC
CCTCTCAGAAAGGCACAGAGCGTGAGAAATCTCTTTTCCCCCCCCGGGGGAGAAATATCTTGTGAAGTGAAATTCTTTT
TCCCACCCCGGGGTCTGGGAGCGAGTGTACCCTCTCCCCCCCCTTTTCCGGTGGGGTCCAGATGTGTTGTGGCTAATGA
AAAGTTCCCCCCCCCAGGGGAATATCTAGAAGTGCCCCCCCTTTTTTTCCCTCCGTGGATTTCCCTATGGGCTCCCTCT
TCTC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Unlabeled
 
4-6
stage 4
stage 5
stage 6
Extraembryonic Mesoderm
Kohler's Sickle
Lateral Plate Mesoderm
Primitive Streak
 
7-12
stage 7
stage 8
stage 8
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Primitive Streak
 
13-18
stage 13
stage 14
stage 15
stage 17
Intermediate Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Somatic Mesoderm
Somites
Spinal Cord
Tail
 
19-24
stage 22
stage 24
Somatic Mesoderm
Somites
Spinal Cord
Tail
 
25-29
stage 25
stage 29
stage 29
stage 29
Gizzard
Somatic Mesoderm
Somites
Spinal Cord
Tail
 

Entry 2

GEISHA IdHOXB5.Sakiyama.2000Data SourcePublication
Complete cDNA Template Probeshow
CGTCAAGCACAGGGTTATAACGACCACGAGCCACAAATCAAGCCCTCCAAAATAACCCAAATGAGCTCTTACTTTGTAA
ACTCGTTCTCAGGGCGCTACCCAAATGGCCCCGACTATCAGTTACTAAATTATGGGACCAGCAGTTCCATGAACGGTTC
TTACAGAGATTCAAGCACCATGCATTCCAGCTCTTATGGCTACAACTACAATGGGATGGACCTTAGCATCAACCGCTCA
GCCTCCTCTAGTCACTTTGGGGCTGTGGGGGAGAGCTCCCGCGGTTTCCCTTCTCCAGCTCAGGAGAGCAGGTTTAGAC
AGGCGTCTAGCTGCTCCTTATCTTCTCCCGACTCCCTTCCCTGCTCCAACAGCGAGAGCCATGGAGGCAAGCCCGCCCC
GTCCCCCTCCGACCAAGCTACTTCTGCCAGCACCAACACAAATTTCACAGAACTAGACGAGACCAGCGCGTCCTCGGGA
GCCGACGAGGGCACTCCAATAAGCAGCAGCATCCCCCGAGCGCAGGCAGAGCCCATCGCAACCTCCACGGCAGCAACAG
AAGGGCAGGCACCTCAGATATTCCCTTGGATGAGGAAACTTCACATTAGTCATGACATGACTGGACCAGACGGGAAGAG
GGCGAGGACAGCGTACACTCGCTACCAGACCCTGGAGTTGGAAAAGGAATTCCACTTCAATAGATATCTCACCCGCAGG
AGGAGAATAGAGATCGCTCACGCTCTGTGCCTCTCCGAGAGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAAT
GGAAGAAGGATAATAAACTGAAAAGCATGAGCTTAGCTTCTGCGGGCAGCGCCTTTCAGCCATAAATTATAGAGGAAGG
AATATCGAGGAAAGAAGAGGAAACATTAAATAAATCCGTAAATAAATAAAGCGCAGCAGATCTTAGTTTTGGAGTACTG
TACAGTGAGGCACCTTCTTTTCGGCATGTTGTTGCTATTCGAAACCGACGCGTATGGTACCTTTATCCCAGGACTGAGT
TCATGTCGTGGTTTTTTCTTTTTTGGGTTGATTTATTAATTTTTTTCCTATTATTTTTTTTTAATTATTATTAAATTTT
ATTTCCAGATGCTCCCCATGCTCTCGTTGTTTTTATAAATGTACGTGTCCGTGCTATCTTGATGCTTTCTGGAAAGCCA
GCATGTTTTATGTGAGCCCTATAAATGTTATAACTTATTTATGAGATGGTAACAGATAACGATTGTTTGTTTATTTGTT
GCTTTTTCCCCTTCCTGAGTTTACTGCTTTGGGGGTGAGTTTTTCTCTGCCTGAGCTAAAATCGGGGGTTCCTGCACTA
CAGTCGCAGTAAAAAATAATAATAAGCAAGAAAAAAAAACATAAAAAAGAGGGGGAAAAAAGAGAAAAAAAAGGGGGAA
AAAGATTAAAAAAATTTAAAAAGGGGAAAAA
CitationSakiyama J, Yokouchi Y, Kuroiwa A. Coordinated expression of Hoxb genes and signaling molecules during development of the chick respiratory tract. Dev Biol. 2000 Nov 1;227(1):12-27.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001025355).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
Lung
 
25-30
stage 27
stage 29
Lung
 
31-34
stage 34
 Figure 2 compares expression of the Hoxb genes in the developing chick respiratory tract at HH stages 24, 27, 29 and 34.

Entry 3

GEISHA IdHOXB5.Barak.2012Data SourcePublication
Complete cDNA Template Probeshow
CGTCAAGCACAGGGTTATAACGACCACGAGCCACAAATCAAGCCCTCCAAAATAACCCAAATGAGCTCTTACTTTGTAA
ACTCGTTCTCAGGGCGCTACCCAAATGGCCCCGACTATCAGTTACTAAATTATGGGACCAGCAGTTCCATGAACGGTTC
TTACAGAGATTCAAGCACCATGCATTCCAGCTCTTATGGCTACAACTACAATGGGATGGACCTTAGCATCAACCGCTCA
GCCTCCTCTAGTCACTTTGGGGCTGTGGGGGAGAGCTCCCGCGGTTTCCCTTCTCCAGCTCAGGAGAGCAGGTTTAGAC
AGGCGTCTAGCTGCTCCTTATCTTCTCCCGACTCCCTTCCCTGCTCCAACAGCGAGAGCCATGGAGGCAAGCCCGCCCC
GTCCCCCTCCGACCAAGCTACTTCTGCCAGCACCAACACAAATTTCACAGAACTAGACGAGACCAGCGCGTCCTCGGGA
GCCGACGAGGGCACTCCAATAAGCAGCAGCATCCCCCGAGCGCAGGCAGAGCCCATCGCAACCTCCACGGCAGCAACAG
AAGGGCAGGCACCTCAGATATTCCCTTGGATGAGGAAACTTCACATTAGTCATGACATGACTGGACCAGACGGGAAGAG
GGCGAGGACAGCGTACACTCGCTACCAGACCCTGGAGTTGGAAAAGGAATTCCACTTCAATAGATATCTCACCCGCAGG
AGGAGAATAGAGATCGCTCACGCTCTGTGCCTCTCCGAGAGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAAT
GGAAGAAGGATAATAAACTGAAAAGCATGAGCTTAGCTTCTGCGGGCAGCGCCTTTCAGCCATAAATTATAGAGGAAGG
AATATCGAGGAAAGAAGAGGAAACATTAAATAAATCCGTAAATAAATAAAGCGCAGCAGATCTTAGTTTTGGAGTACTG
TACAGTGAGGCACCTTCTTTTCGGCATGTTGTTGCTATTCGAAACCGACGCGTATGGTACCTTTATCCCAGGACTGAGT
TCATGTCGTGGTTTTTTCTTTTTTGGGTTGATTTATTAATTTTTTTCCTATTATTTTTTTTTAATTATTATTAAATTTT
ATTTCCAGATGCTCCCCATGCTCTCGTTGTTTTTATAAATGTACGTGTCCGTGCTATCTTGATGCTTTCTGGAAAGCCA
GCATGTTTTATGTGAGCCCTATAAATGTTATAACTTATTTATGAGATGGTAACAGATAACGATTGTTTGTTTATTTGTT
GCTTTTTCCCCTTCCTGAGTTTACTGCTTTGGGGGTGAGTTTTTCTCTGCCTGAGCTAAAATCGGGGGTTCCTGCACTA
CAGTCGCAGTAAAAAATAATAATAAGCAAGAAAAAAAAACATAAAAAAGAGGGGGAAAAAAGAGAAAAAAAAGGGGGAA
AAAGATTAAAAAAATTTAAAAAGGGGAAAAA
Citation Barak H, Preger-Ben Noon E, Reshef R. Comparative spatiotemporal analysis of Hox gene expression in early stages of intermediate mesoderm formation. Dev Dyn. 2012 Oct;241(10):1637-49.
CopyrightCopyright © 2012 Wiley Periodicals, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_001025355.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
stage 6
stage 6
Kohler's Sickle
Lateral Plate Mesoderm
Primitive Streak
 
7-11
stage 7
stage 7
stage 8
stage 8
stage 9
stage 9
stage 10
stage 10
stage 11
stage 11
Area Opaca
Blood Vessels
Central Nervous System
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Primitive Streak
Somites
Tail
 

Entry 4

GEISHA IdHoxb5.Bel-Vialar.2002Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CGTCAAGCACAGGGTTATAACGACCACGAGCCACAAATCAAGCCCTCCAAAATAACCCAAATGAGCTCTTACTTTGTAA
ACTCGTTCTCAGGGCGCTACCCAAATGGCCCCGACTATCAGTTACTAAATTATGGGACCAGCAGTTCCATGAACGGTTC
TTACAGAGATTCAAGCACCATGCATTCCAGCTCTTATGGCTACAACTACAATGGGATGGACCTTAGCATCAACCGCTCA
GCCTCCTCTAGTCACTTTGGGGCTGTGGGGGAGAGCTCCCGCGGTTTCCCTTCTCCAGCTCAGGAGAGCAGGTTTAGAC
AGGCGTCTAGCTGCTCCTTATCTTCTCCCGACTCCCTTCCCTGCTCCAACAGCGAGAGCCATGGAGGCAAGCCCGCCCC
GTCCCCCTCCGACCAAGCTACTTCTGCCAGCACCAACACAAATTTCACAGAACTAGACGAGACCAGCGCGTCCTCGGGA
GCCGACGAGGGCACTCCAATAAGCAGCAGCATCCCCCGAGCGCAGGCAGAGCCCATCGCAACCTCCACGGCAGCAACAG
AAGGGCAGGCACCTCAGATATTCCCTTGGATGAGGAAACTTCACATTAGTCATGACATGACTGGACCAGACGGGAAGAG
GGCGAGGACAGCGTACACTCGCTACCAGACCCTGGAGTTGGAAAAGGAATTCCACTTCAATAGATATCTCACCCGCAGG
AGGAGAATAGAGATCGCTCACGCTCTGTGCCTCTCCGAGAGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAAT
GGAAGAAGGATAATAAACTGAAAAGCATGAGCTTAGCTTCTGCGGGCAGCGCCTTTCAGCCATAAATTATAGAGGAAGG
AATATCGAGGAAAGAAGAGGAAACATTAAATAAATCCGTAAATAAATAAAGCGCAGCAGATCTTAGTTTTGGAGTACTG
TACAGTGAGGCACCTTCTTTTCGGCATGTTGTTGCTATTCGAAACCGACGCGTATGGTACCTTTATCCCAGGACTGAGT
TCATGTCGTGGTTTTTTCTTTTTTGGGTTGATTTATTAATTTTTTTCCTATTATTTTTTTTTAATTATTATTAAATTTT
ATTTCCAGATGCTCCCCATGCTCTCGTTGTTTTTATAAATGTACGTGTCCGTGCTATCTTGATGCTTTCTGGAAAGCCA
GCATGTTTTATGTGAGCCCTATAAATGTTATAACTTATTTATGAGATGGTAACAGATAACGATTGTTTGTTTATTTGTT
GCTTTTTCCCCTTCCTGAGTTTACTGCTTTGGGGGTGAGTTTTTCTCTGCCTGAGCTAAAATCGGGGGTTCCTGCACTA
CAGTCGCAGTAAAAAATAATAATAAGCAAGAAAAAAAAACATAAAAAAGAGGGGGAAAAAAGAGAAAAAAAAGGGGGAA
AAAGATTAAAAAAATTTAAAAAGGGGAAAAA
CitationSophie Bel-Vialar, Nobue Itasaki, Robb Krumlauf. Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 2002 Nov;129(22):5103-15.
CopyrightCopyright © The Company of Biologists Limited 2002.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_001025355.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
Lateral Plate Mesoderm
Somites
Spinal Cord
in between HH stage 11-13

Entry 5

GEISHA IdHOXB5.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
ATGAGCTCTTACTTTGTAAACTCGTTCTCAGGGCGCTACCCAAATGGCCCCGACTATCAGTTACTAAATTATGGGACCA
GCAGTTCCATGAACGGTTCTTACAGAGATTCAAGCACCATGCATTCCAGCTCTTATGGCTACAACTACAATGGGATGGA
CCTTAGCATCAACCGCTCAGCCTCCTCTAGTCACTTTGGGGCTGTGGGGGAGAGCTCCCGCGGTTTCCCTTCTCCAGCT
CAGGAGAGCAGGTTTAGACAGGCGTCTAGCTGCTCCTTATCTTCTCCCGACTCCCTTCCCTGCTCCAACAGCGAGAGCC
ATGGAGGCAAGCCCGCCCCGTCCCCCTCCGACCAAGCTACTTCTGCCAGCACCAACACAAATTTCACAGAACTAGACGA
GACCAGCGCGTCCTCGGGAGCCGACGAGGGCACTCCAATAAGCAGCAGCATCCCCCGAGCGCAGGCAGAGCCCATCGCA
ACCTCCACGGCAGCAACAGAAGGGCAGGCACCTCAGATATTCCCTTGGATGAGGAAACTTCACATTAGCCATGACATGA
CTGGACCAGACGGGAAGAGGGCGAGGACAGCGTACACTCGCTACCAGACCCTGGAGTTGGAAAAGGAATTCCACTTCAA
TAGATATCTCACCCGCAGGAGGAGAATAGAGATCGCTCACGCTCTGTGCCTCTCCGAGAGGCAGATCAAAATCTGGTTC
CAGAACAGGAGGATGAAATGGAAGAAGGATAATAAACTGAAAAGCATGAGCTTAGCTTC
CommentsImages and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Allantois
Extraembryonic Blood Vessels
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Somites
Tail
 

Entry 6

GEISHA IdHOXB5.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CGTCAAGCACAGGGTTATAACGACCACGAGCCACAAATCAAGCCCTCCAAAATAACCCAAATGAGCTCTTACTTTGTAA
ACTCGTTCTCAGGGCGCTACCCAAATGGCCCCGACTATCAGTTACTAAATTATGGGACCAGCAGTTCCATGAACGGTTC
TTACAGAGATTCAAGCACCATGCATTCCAGCTCTTATGGCTACAACTACAATGGGATGGACCTTAGCATCAACCGCTCA
GCCTCCTCTAGTCACTTTGGGGCTGTGGGGGAGAGCTCCCGCGGTTTCCCTTCTCCAGCTCAGGAGAGCAGGTTTAGAC
AGGCGTCTAGCTGCTCCTTATCTTCTCCCGACTCCCTTCCCTGCTCCAACAGCGAGAGCCATGGAGGCAAGCCCGCCCC
GTCCCCCTCCGACCAAGCTACTTCTGCCAGCACCAACACAAATTTCACAGAACTAGACGAGACCAGCGCGTCCTCGGGA
GCCGACGAGGGCACTCCAATAAGCAGCAGCATCCCCCGAGCGCAGGCAGAGCCCATCGCAACCTCCACGGCAGCAACAG
AAGGGCAGGCACCTCAGATATTCCCTTGGATGAGGAAACTTCACATTAGTCATGACATGACTGGACCAGACGGGAAGAG
GGCGAGGACAGCGTACACTCGCTACCAGACCCTGGAGTTGGAAAAGGAATTCCACTTCAATAGATATCTCACCCGCAGG
AGGAGAATAGAGATCGCTCACGCTCTGTGCCTCTCCGAGAGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAAT
GGAAGAAGGATAATAAACTGAAAAGCATGAGCTTAGCTTCTGCGGGCAGCGCCTTTCAGCCATAAATTATAGAGGAAGG
AATATCGAGGAAAGAAGAGGAAACATTAAATAAATCCGTAAATAAATAAAGCGCAGCAGATCTTAGTTTTGGAGTACTG
TACAGTGAGGCACCTTCTTTTCGGCATGTTGTTGCTATTCGAAACCGACGCGTATGGTACCTTTATCCCAGGACTGAGT
TCATGTCGTGGTTTTTTCTTTTTTGGGTTGATTTATTAATTTTTTTCCTATTATTTTTTTTTAATTATTATTAAATTTT
ATTTCCAGATGCTCCCCATGCTCTCGTTGTTTTTATAAATGTACGTGTCCGTGCTATCTTGATGCTTTCTGGAAAGCCA
GCATGTTTTATGTGAGCCCTATAAATGTTATAACTTATTTATGAGATGGTAACAGATAACGATTGTTTGTTTATTTGTT
GCTTTTTCCCCTTCCTGAGTTTACTGCTTTGGGGGTGAGTTTTTCTCTGCCTGAGCTAAAATCGGGGGTTCCTGCACTA
CAGTCGCAGTAAAAAATAATAATAAGCAAGAAAAAAAAACATAAAAAAGAGGGGGAAAAAAGAGAAAAAAAAGGGGGAA
AAAGATTAAAAAAATTTAAAAAGGGGAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI ( NM_001025355).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.22931

Mouse

EmageMGI:96186
EurexpressMGI:96186
MGI GXDMGI:96186

Frog

Xenbase1005990

Fruit Fly

BDGPFBgn0003339

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-70, ZDB-GENE-000823-6
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona