GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HOXC6
homeobox C6

Gene
Official SymbolHOXC6
Official Full Namehomeobox C6
CGNC ID64714
also known asHOXC-6, homeobox protein Hox-C6|homeo box C6|homeobox protein C6
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_003643454
PolypeptideXP_003643502
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.47465
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100858368
Ensembl Gene
KEGGgga:100858368

Entry 1

GEISHA IdChEST412N18Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGGCTCGAGCGGGTCAGCTGACTTGTCATTTGTCTGTCCTGGAGCAGAGCCTTCCCTATAACAATCTAGTTCAGACTA
CAAACTGGAGACAGAAATAAATATTAAAGAAATCACACAGCCAGGTATAGAGGACGATATGAATTCCTATTTCACAAAC
CCATCTTTATCCTGCCATCTAACCAGTGGCCAAGAGGTGCTTCCCAACGTAGCCCTCAATTCAACTGCCTATGACCCTG
TCAGGCATTTTTCTACTTATGGAGCAGCCGTTGCTCAAAACCGGATTTATTCTTCTCCTTTTTATTCACCGCAAGATAA
TGTTGTGTTTAGCTCCAGCCGAGGACCTTATGACTATGGATCTAATGCTTTTTACCAAGAAAAAGACATGCTTTCTAGC
TGCAGGCAAAATTCTATGGGACATAATACACAGACATCAATCGCACAGGATTTTACCAGTGACCAAAACAGGAACACTT
CGCAAGAACAAAAAACTAGCATTCAAATATACCCATNGGATGCAGCGTATGAACTCCCACAGTGGTAAGTTTTACAGCT
CGGAGATATAAATTAAATAAACTGAACCATCTTTACGACTTCTCCCTAGCAGAACCAGGCTGAGCGACTTTTTTATGGC
CCATAAAAACAATAATATAGCTCCTTCAACAGTTGCAGCTACAGGCCTTTAATTTGTAGGTTGGTTGCAAGCAATATGG
Commentsno specific expression detected stages 6-15. Probe supposed to be Hox-c6
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 19
stage 22
Paraxial Mesoderm
Somites
Spinal Cord
caudal embryo

Entry 2

GEISHA IdHoxc-6.Reid.2002Data SourcePublication
Complete cDNA Template Probeshow
GGCGTGGGCTACGGGGCCGACCGCCGGCGGGGCCGCCAGATTTATTCCCGTTACCAAACGTTGGAGCTGGAGAAGGAAT
TTCACTTCAACCGCTACCTGACGAGGCGGAGGCGGATCGAAATCGCCAACGCTCTCTGCCTGACGGAACGGCAGATCAA
GATTTGGTTCCAGAACCGAAGGATGAAATGGAAAAAAGAAAGCAACTTAAGCTCGACCCTCTCCGGGGCGGGTGGTGGA
ACCGCGGCCGCCGCGGATAGTTTGGCCAAGGAGGAGGGATACTGCTCTCAGATGTTGGGTGCTGTGTGAAGCCCAGAAT
TGGACTCAGTGATCCTTGTGGGTCCCTTCCAACTCAGGGTTATTCTATGATTCACGGTTGCCTCTCTGATCTTGTCTAT
CATCTAACAGTTTCTAGGGGGGGGCATGGCAATGGCTGAATAATCAGCTGTAAGAGACAGGGCATGATTCTTTCAAGGT
GGCTGCCGTAAATCCAGTGGACTTGCTTTGCCAGCCAAGGAGAGCTTTGATTCTTGATCTCTGGTGCTTTGCCAGGAGG
CCATTGAGGAGAATGCTACCACTGCTGTTGGCTCTCCCTCAGCATCAGCGCCTTCTTTCCCTGCAG
CitationReid AI, Gaunt SJ. Colinearity and non-colinearity in the expression of Hox genes in developing chick skin. Int J Dev Biol. 2002 Mar
CopyrightCopyright © 2007 UBC Press
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (X80114).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
Hindbrain
Spinal Cord
Surface Ectoderm
 
31-44
stage 44
 Comparison of several genes

Entry 3

GEISHA IdHoxc-6.Nelson.1996Data SourcePublication
Complete cDNA Template Probeshow
CCCCCCCCCAAAAAAAAGCCCCGGGGCCGCCGGGGGGGGTCGTTTTGGGGGTTCAGGACTTACTTTCAATGCACACTTA
GTTTCAACTAGGGAATCAACAGAAGCAAAAGCAATTTTTCCCTTTTTGACACCCGCCTCCCCATTGGCTCCCCCCGGGT
CAGCTGACTTTGTCATTTTGTCTGTCCTGGAGCAGAGCCTTCCCTATAACAATCTAGTTCAGACTACAAACTGGAGACA
GAAATAAATATTAAAGAAATCACACAGCCAGGTATAGAGGACGATATGAATTCCTATTTCACAAACCCATCTTTATCCT
GCCATCTAACCAGTGGCCAAGAGGTGCTTCCCAACGTAGCCCTCAATTCAACTGCCTATGACCCTGTCAGGCATTTTTC
TACTTATGGAGCAGCCGTTGCTCAAAACCGGATTTATTCTTCTCCTTTTTATTCACCGCAAGATAATGTTGTGTTTAGC
TCCAGCCGAGGACCTTATGACTATGGATCTAATGCTTTTTACCAAGAAAAAGACATGCTTTCTAGCTGCAGGCAAAATT
CTATGGGACATAATACACAGACATCAATCGCACAGGATTTTACCAGTGACCAAAACAGGAACACTTCGCAAGAACAAAA
AACTAGCATTCAAATATACCCATGGATGCAGCGTATGAACTCCCACAGTGTGTGTTTTGTCTCGGCTCCCCCAGGCGTG
GGCTACGGGGCCGACCGCCGGCGGGGCCGCCAGATTTATTCCCGTTACCAAACGTTGGAGCTGGAGAAGGAATTTCACT
TCAACCGCTACCTGACGAGGCGGAGGCGGATCGAAATCGCCAACGCTCTCTGCCTGACGGAACGGCAGATCAAGATTTG
GTTCCAGAACCGAAGGATGAAATGGAAAAAAGAAAGCAACTTAAGCTCGACCCTCTCCGGGGCGGGTGGTGGAACCGCG
GCCGCCGCCGCCGATAGTTTGGCCAAGGAGGAGAAGCGAGAAGAGACAGAGGAGGAGAAGCAGAAGGAGTGAAAAGTGG
CAGCGCTCCCCACCCCCCCCCCACACACCTC
CitationNelson CE, Morgan BA, Burke AC, Laufer E, DiMambro E, Murtaugh LC, Gonzales E, Tessarollo L, Parada LF, Tabin C. Analysis of Hox gene expression in the chick limb bud. Development. 1996 May;122(5):1449-66.
CopyrightCopyright © 1996 by Company of Biologists
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI ( XM_015300352).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
stage 23
stage 23
Leg
Wing
 
25-30
stage 25
stage 25
stage 25
stage 25
stage 25
Leg
Limb Buds
Wing
 
31-44
stage 44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.47465

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona