GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

IRX2
iroquois homeobox 2

Gene
Official SymbolIRX2
Official Full Nameiroquois homeobox 2
CGNC ID48986
also known asiroquois-class homeodomain protein IRX-2|iroquois homeobox protein 2|iroquois homologue 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001030336
PolypeptideNP_001025507
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2980
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human153572ENSG00000170561MIM:606198
Mouse16372ENSMUSG00000001504All phenotypic alleles (3):Targeted, other(3) MGI:1197526
Xenopus493475, 378497480617
Zebrafish394032ENSDARG00000001785ZDB-GENE-040426-1446ZFIN:ZDB-GENE-040426-1446
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene373975
Ensembl Gene
KEGGgga:373975

Entry 1

GEISHA IdIRX2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATTCCCCTTACGACGCCCATAC
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGTTTGAAGCCACTGCCGCCGAGTTGcDNA Template Length518
Complete cDNA Template Probeshow
GGGGATGACCGGGGCCATCAGTACCACCGTAGGCAGCCCTGCCTACCCCTCCAGTCAAGACCCCGCGTACAGGAAGAAT
GCCACCCGGACGCCACGGCCACGCTGAAGGCCTGGCTGCAGGAGCACGCAAGAACCCCTACCCCACCAAGGGCGAGAAG
ATCATGTGGCCATCATCACCAAGTGCCCTCACCCAGGTCTCCACCTGGTTTGCCAATGCCGCCGCCGCCTCAAGAAGGA
GAACAAGATGACGTGGGCCCCGCGGAACAAGAGTGAGGACGAGGACGACGACGATGGCGACGGGGCGAGGATAAGAGAG
AGCCCTGACAAGATACCGAAGCACGAGACCTGCCGAGGAGAAGGGATCAGCTTGCGTGGACTCGTGACGGACCACTCGT
GCTCCCGAGTCGGACAGCGCTGCTACTCCCTCCTCTCTGGGGAGGCATATTTATTACTCACCTTTTTATAGCAATTACA
CAATATGGGAATTTAACGCTCTCCAAGCAGGGGATCCTGAGATA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Early Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Unlabeled
Low level expression.
7-12
stage 7
stage 7
stage 7
stage 8
stage 9
stage 10
stage 10
stage 11
stage 12
Anterior Intestinal Portal
Anterior/Second Heart Field
Head Mesenchyme
Heart
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Paraxial Mesoderm
Cardiogenic mesoderm
Dorsal view.
Sections pending.
13-18
stage 14
stage 17
Head Mesenchyme
Heart Tube
Hindbrain
Lateral Plate Mesoderm
Liver
Midbrain
Neural Plate/Tube
Sections pending.
19-24
stage 22
Head Mesenchyme
Heart
Hindbrain
Lateral Plate Mesoderm
Limb Buds
Midbrain
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Retina
Sections pending.
25
stage 25
Head Mesenchyme
Heart
Hindbrain
Lateral Plate Mesoderm
Leg
Midbrain
Myocardium
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Retina
Wing
Wing Mesenchyme
Sections pending.

Entry 2

GEISHA IdIRX2.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
ATGTCCTATCCTCAGGGTTACCTCTACCAGCCCCCCGGCTCGCTGGCTCTGTACTCCTGCCCGGCGTACGGAGCGTCGG
CGCTGGCGGCCCCCAGGAGCGAGGAGCTGGCCAGGTCTTCGTCGGGCTCGGCGTTCAGCCCTTATCCGGGATCGGCAGC
TTTCACCGCCCAGGCGGCGGCCACAGGCTTCACCAGCCCGCTCCAGTACTCCACAGACCCCGCCACGGGATTCCCCTCC
TACATGGGCTCCCCTTACGACGCCCATACGACGGGGATGACCGGGGCCATCAGCTACCACCCGTACGGCAGCCCTGCCT
ACCCCTACCAGCTCAACGACCCCGCGTACAGGAAGAATGCCACCCGCGACGCCACGGCCACGCTGAAGGCCTGGCTGCA
GGAGCACCGCAAGAACCCCTACCCCACCAAGGGCGAGAAGATCATGCTGGCCATCATCACCAAGATGACCCTCACCCAG
GTCTCCACCTGGTTTGCCAACGCCCGCCGCCGCCTCAAGAAGGAGAACAAGATGACGTGGGCCCCGCGAAACAAGAGTG
AGGACGAGGACGACGACGATGGCGACGGGGCGAGGAGTAAAGAGGAGAGCCCTGACAAGATACCCGAGAGCAACGAGAC
CTCCGCCGAGGACGAAGGGATCAGCTTGCAAGTGGACTCGCTGACGGACCACTCGTGCTCCGCCGAGTCGGACGGCGAG
AAGCTGCCGTGCCGGGCCGGCGACCCCCTGTGCGAGTCGGGTTCGGAGTGCAAGGACAAGTACGAGGACATCGAAGAGG
AAGAGGAAGACGAGGACGATGACGAGGAGGACATCGAGGAGGACGACGGCGGCGGCGGGGAGCGCGACCCGCCGGCCAA
GCCAGCCACCTCCTCGCCTCTGGCCGCCGTGGAGGCCCCTCTGCTCGGCCACCCGCACGCCGACGCCGCCCGCAGCGCC
AGCAAGGCGGCGCTGGGCGGCCGCGCCTCCCCCGGGCCCCCGACGCCGGCCAGCAAGCCCAAGCTCTGGTCGCTGGCCG
AAATCGCCACCTCGGACCTCAAGAGCCAGAACTTGGGCCAAGGCTGCCCGCCGGCAGCGTTGGCCTCGGCCACCCCCGC
CTCCGCCCCGCACAGCGCTGCCTACTCTCCCTCCTCCCTTCTGGGGAGGCATATTTATTACACCTCACCTTTTTATAGC
AATTACACAAACTATGGGAACTTTAACGCTCTCCAGAGCCAGGGGATCCTGAGATACAACTCGGCGGCAGTGGCTTCAA
ACGAGGGACTCAGTCAGACTGTCCTAAATGCCAGCTCTGTCCACAAGCAGAGCAGTGACTCTTTGAAAACGATCACTAA
CCAGCTAGAACAACATTACAGGCCCTCTAGTTATGACTCTAAGAAAGATCCCACTGAAGTCTGCACAGTAGGAGTACAA
CCATACCTATAG
CommentsImages provided by Claire Anderson. As insufficient information was provided to verify sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_001030336.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Area Opaca
Lateral Plate Mesoderm
Paraxial Mesoderm
 
7-12
stage 7
stage 8
stage 8
stage 8
stage 8
stage 9
stage 9
stage 10
stage 11
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Amnion
Anterior Intestinal Portal
Atria
Ear/Otic Placode
Ectoderm
Endoderm
Forebrain
Foregut
Head Mesenchyme
Head Process
Heart
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesencephalon
Midbrain
Myocardium
Neural Crest
Neural Plate/Tube
Paraxial Mesoderm
Pharynx
Sinus Venosus
Somatic Mesoderm
Somites
Splanchnic Mesoderm
Ventricles
Widespread Expression
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
HH12+
HH8-
HH9+
Ventral view
section 1
section 26
section 34
section 56
section 66
section 72
13
stage 13
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2980

Mouse

EmageMGI:1197526
EurexpressMGI:1197526
MGI GXDMGI:1197526

Frog

Xenbase480617

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-1446
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona