GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

IRX3
iroquois homeobox 3

Gene
Official SymbolIRX3
Official Full Nameiroquois homeobox 3
CGNC ID
also known asiroquois-class homeodomain protein IRX-3|iroquois homeobox protein 3|iroquois homologue-3 homeodomain
gene typeunknown
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNA
Polypeptide
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene107054273
Ensembl Gene
KEGG

Entry 1

GEISHA IdIRX3.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
CTGNGTCCACTCAGATCAATAGGAAAAGTGCGAGAAGAAAGCAGCGCGCGGCGCGCAGCGCGGCCGCAGCCAGGCGGGA
GCCGCGGCCTCCGAGCTCCGCTCCCGATGCGGCCCGGAGCCGGCGGCGGGCGCTGAGCGCTGAGCTGTGCCGGCGGCCC
CGCGGCCAGCCCCGCCGCTCGCTGCCCTTTCTCTCCCTTCTTCCCTTCTGCCCCCCCCTCCCTACCCTTCNCCCCTCCC
CNCCCCCCC
CommentsImages and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
Amnion
Anterior Intestinal Portal
Blood Islands
Dermomyotome
Ear/Otic Placode
Ectoderm
Endoderm
Head Mesenchyme
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Notochord
Outflow Tract
Pharynx
Somites
Splanchnic Mesoderm
Yolk Sack or Stalk
extraembryonic mesoderm
section 12
section 18
section 34

Entry 2

GEISHA IdIRX3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
AGATCAATAGGAAAAGTGCGAGAAGAAAGCAGCGCGCGGCGCGCAGCGCGGCCGCAGCCAGGCGGGAGCCGCGGCCTCC
GAGCTCCGCTCCCGATGCGGCCCGGAGCCGGCGGCGGGCGCTGAGCGCTGAGCTGTGCCGGCGGCCCCGCGGCCAGCCC
CGCCGCTCGCTGCCCTTTCTCTCCCTTCTTCCCTTCTGCCCCCCCCTCCCTACCCTTCCCCCCTCCCCACCCCCCCCGC
ACCATGTCGTTCCCGCAGCTGGGCTACCAGTACATCAGGCCGCTGTACCCCGCCGAGCGCCCGGGCAGCGGCGGCTCCC
GAGGCGGCGCGGAGCTGGCCCCGTCCGGGACCCTCTCCAACGTGCTCTCCTCCATGTACGGCGCGCCCTACGCCGCCGC
CGCCGCCGCTCAGGGCTACGGAGCCTTCCTGCCCTACGCCGCCGAACTGCCCATCTTCCCGCAGCTGGGCGCGCAGTAC
GAGCTGAAGGAGAGCCCCGGGGTGCAGCACGCCGCCTTCCCGCATCACCACCCCGCTTTCTACCCCTACGGGCAGTACC
AGTTCGGGGACCCGTCGCGGCCCAAGAACGCCACCCGCGAGAGCACCAGCACGCTCAAGGCCTGGCTCAACGAGCACCG
CAAGAACCCGTACCCCACCAAGGGTGAGAAGATCATGCTGGCCATCATCACCAAGATGACCCTCACCCAGGTCTCCACC
TGGTTCGCCAACGCTCGGCGGCGGCTCAAGAAGGAGAACAAGATGACCTGGGCCCCCCGCAGCAGGACGGACGAGGAGG
GCAACTCCTACGGCAGCGACCACGAGGGGGAAGAGGACAAGAGGGAGGACGAGGAGGAGATCGACCTGGAGAACATCGA
CACCGAGAACATCGAGAGCGCCAAGGACGAGCTGGAGGACGAGCTCCAGGACGCGGACCTGCTGCACTCCGACTCCAAG
ACGGACTCGGAGGGCTCCGAGGGCTTCGAGGACCTGCCCGGCTCCGAGGAGCGCTACCTCGGTCCGGCCGCCGCAGCCG
CCGCGGAGCCGCTCCGCCTCCGCCACCACCACCTCCGCCACCACCGCCACCACCGCCGCCCGCCCTGCGAGCTGCCCTC
CGCCGGCCCCGAGCCGCCGCCGCCCGCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCACCTCTCGCCCCCCTCC
TCCGCCTCCTCGTCGTCCGCCTCCTCCCCGACGGACGCCGCTTCGGCCGGCACCGTGCCGAAGCCCAAGATCTGGTCGC
TGGCCGAGACGGCCACCAGCCCGGACAACCCCCGCAAGTCTCCCGGCTCCCCGCCGGCGGCCGCCCCCCAGCCGCTGCC
GCTGCCCCCCCCGCCGCCCCACAGACTCGTCTCCTCCTGCCCGCTGGGCAAGTTCCCCAACTGGACCAACCGCGCCTTC
CCGGCCGCCTCCCCGCACCACCACGCGGCCCCGCACCCGCTGGCCTTACTGAACACTCCGCACCTGCTGGGGCTGGGGG
CCGCCCCCGCCGCCGCCGCCGCCTTCCCGCGGCCCGCGGAGCAGGCGCCGAGCGCGGAGCCCCCCGGAGCAGATCGATC
TAGTGCCTTGGAAGTAGAGAAAAAGTTAATAAAGACAGCTTTCCAGCCAGTGCAGAGGCGGCCCCAGAACCAGCTCGAT
GCCGCCATGGTTCTATCGGCGCTGTCATCGTCTTAGTTAATTTTTTATCGTTGTTGTAATGATTGTAAAAAGAAATCTC
TGTATAGTTACGACGTTACGCATGTCCGTATGGTAAAACTAAAAAGGAAAAGACAAAAATACAGCCCCGCTTCTGTGCT
CCCCCCGGGTCCCGGGCCGTGCGGTTGGTGGAAGTCCCGTGAGCGTCCGTTCGGTGTCTCGGTTTTTGGTTTTTATTTT
TTGTTTGTTTGTTTGGTTGGTTGGTTTTGTACATACCGTCAAACCTGTACATACGTGTGAACCAAATTGTACGAGAAAG
TATCTATTTTTGGCTAATAAAGACACGGTTGCCACTTTGCCTACA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_015292372).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona