GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

JADE2
jade family PHD finger 2

Gene
Official SymbolJADE2
Official Full Namejade family PHD finger 2
CGNC ID4840
also known asPHF15, protein Jade-2|E3 ubiquitin-protein ligase Jade-2|PHD finger protein 15, Protein Jade-2, PHD finger protein 15
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_414632
PolypeptideXP_414632
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.50101
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human23338ENSG00000043143MIM:610515
Mouse76901ENSMUSG00000020387MGI:1924151
Xenopus100127822, 7332785880520
Zebrafish569359ENSDARG00000053389
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene416315
Ensembl Gene
KEGGgga:416315

Entry 1

GEISHA Idpat.pk0052.a4Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CCGTGGTCAGAATCATACCCCAGCTGGAGAACCTGCCTTCCCCGGTGTCCCCCAGCAGCCTGCAGGGCTCTGAGATTTC
GGAAGCCACGAGGACGTACCTGCAGGGCATGAGCCGCTACGACCTGGATGAGCTGGATGCCTGCTGGTTGGAGCTCGTG
AACATGGAGCTCAAGGAGATGGAAAAGCCCGAGCTGGATGAGATCACCCTGGAGAGAGTGCTGGAGGAGCTGGAGACGA
TGTGCTACGAGAACATGAACATCGCCATTGAAACAGAGGAGGGCCTGGGCATCGAGTACGACGAGGACGTGGTGTGTGA
CGTCTGCCGCTCGCCGGAGGGGGAGGATGGCAACGAGATGGTGTTCTGTGACAAGTGCAACGTCTGCGTGCACCAGGCA
TGCTATGGCATCCTGAAGGTCCCCATCGGCAGCTGGCTGTGCCGGACCTGCGCCCTCGGCGTCCAGCCCAAGTGTTTGC
TGTGCCCGAAGAGAGGGGGAGCACTGAAACCCACTCGGAGTGGGACGAAATGGGTCCACGTTAGCTGTGCCTTATGGAT
ACCTGAAGTTAGCATTGGATGTCCTGAAAAAATGGAACCCATTACGAAGATCTCACATATCCCAGCGAGCAGATGGGCT
CTGTCCTGCAGCCTCTGCAAGGAATGCACGGGGACCTGCATTCAGTGCTCCATGCCCGCCTGCGTCACCGCGTTCCACG
TCACCTGCGCCTTCGACCACAACCTCGACATGCGGACTATTTTAGCAGACAACGATGAAGTGAAGTTCAAGTCCTTCTG
CCTGGAGCACAGCACCGGTGCCACCAAACTACCCGAGGAGGCGCGGACGGAACCTGACCAAGCCCAGCTGGACCTGG
Commentsno specific expression detected stages 4, 11, 16, 20, 24
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
Unlabeled
 

Entry 2

GEISHA IdJADE2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer3'-CCAAGTGTTTGCTGTGCCC-5'
Reverse cDNA Template Primer3'-TTGTTCAGGGACCACTCGC-5'cDNA Template Length1033
Complete cDNA Template Probeshow
AAGTGTTTGCTGTGCCCGAAGAGAGGGGGAGCACTGAAACCCACTCGGAGTGGGACGAAATGGGTCCACGTTAGCTGTG
CCTTATGGATACCTGAAGTTAGCATTGGATGTCCTGAAAAAATGGAACCCATTACGAAGATCTCACATATCCCAGCGAG
CAGATGGGCTCTGTCCTGCAGCCTCTGCAAGGAATGCACGGGGACCTGCATTCAGTGCTCCATGCCCGCCTGCGTCACC
GCGTTCCACGTCACCTGCGCCTTCGACCACAACCTCGACATGCGGACTATTTTAGCAGACAACGATGAAGTGAAGTTCA
AGTCCTTCTGCCTGGAGCACAGCACCGGTGCCACCAAACTACCCGAGGAGGCGCGGACGGAACCTGACCAAGCCCAGCT
GGACCTGGAGAAGGTGACGCTGCGGAAGCAAAAGCTCCAGCAGCTGGAGGAGGACTTCTATGAACTCGTGAAGCCTTCC
GAGGTGGCAGAGAACCTCGACTTAAGTGAGTCGCTGGTGGATTTTGTCTATCAGTACTGGAAGCTGAAGAGGAAAGCGA
ACTCCAACAAACCACTGCTGACACCAAAAACGGATGAAGTGGACAACTTGGCTCAGCAGGAGCAGGATGTTCTCTACCG
GCGCTTGAAGCTTTTCACGCACCTCAGGCAAGACCTGGAGAGGGTTAGAAATCTCTGTTACATGGTGACGAGACGGGAG
AAAATGAAGCACACCATTTGTAAACTCCAGGAGCAGATCTTCCACCTGCAGATGATACTCATTGAGAAGGACCTTTACC
CAGAACAAACTGGGAAGAAGACAAAGGGTAAGAAAAGTGATCCGAGAAGGAAAGGAAGAGATGGTAGAAAAAATAGCCC
TGAGAAGAAAGAAAAAAGGAAATCAGTCAACGAAACTGTGTTGGGACAACTGGGCTTGTCGACTTCCTTCCCCATCGAT
GGGACCTTCTTCAACAGCTGGCTGGCGCAGTCGGTGCAGATCACGGCCGAGAACATGGCCATGAGCGAGTGGTCCCTGA
ACAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Unlabeled
 
13-18
stage 18
Unlabeled
 
19-24
stage 20
stage 23
stage 23
Unlabeled
 
25
stage 25
Unlabeled
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.50101

Mouse

EmageMGI:1924151
EurexpressMGI:1924151
MGI GXDMGI:1924151

Frog

Xenbase5880520

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona