GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KDM4A
lysine demethylase 4A

Gene
Official SymbolKDM4A
Official Full Namelysine demethylase 4A
CGNC ID7658
also known asJMJD2A, lysine-specific demethylase 4A|jumonji domain containing 2A|lysine (K)-specific demethylase 4A
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_422410
PolypeptideXP_422410
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly35744FBgn0033233
Human9682ENSG00000066135MIM:609764
Mouse230674ENSMUSG00000033326All phenotypic alleles (1):Targeted, other(1) MGI:2446210
Xenopus1001353501010380
Zebrafish334347ENSDARG00000019103ZDB-GENE-030131-6279, ZDB-GENE-110609-4ZFIN:ZDB-GENE-030131-6279, ZFIN:ZDB-GENE-110609-4
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene424571
Ensembl GeneENSGALG00000010074
KEGGgga:424571
GEISHA IdJmjD2A.Strobl-Mazzulla.2010Data SourcePublication
Complete cDNA Template Probeshow
GCGGCGGCCTGCGGGAGTCACCGGGCGCGGAGTGCGAAGGGATACGGCGGCGTGGCGGAGAGCCAGTGGGAGGGCGGAA
GAGGCGAAGAAGCGGGACGCGGAGCTGACCGGCGGCCCGGCACCATGGCCTCGGAGCTGGAGAGCCTCAACCCCAGCGC
GCGCATCATGACCTTCCGTCCCACCATGGAGCAGTTCCGGGACTTCAGCCGCTACATCGCTTACGTGGAGGCGCAGGGA
GCGCACCGCGCCGGGCTGGCCAAGATCGTGCCCCCCAAGGAGTGGAAGCCGCGGAAGTGCTACGACGACATTGATGAGC
TGGTGATCCCCGCACCCATCCAGCAGGTGGTGACCGGGCAGTCCGGGCTCTTCACGCAGTACAACATCCAGAAGAAGGC
CATGACGGTGCGCGAGTTCCGCCGGATCGCCAACAGCGACAAGTACTGCACACCCCGCTACACAGACTTCGAAGACCTT
GAACGAAAGTACTGGAAGAACCTTACGTTCAATGCCCCCATCTATGGTGCTGATGTTAATGGCACGCTTTATGACAAGC
ACGTGGATGCGTGGAATATTGGCAGATTGAACACGATCCTGGATGTTGTGGAGAATGAGAGCGGCATAACCATTGAAGG
AGTGAATACTCCTTACCTCTATTTTGGCATGTGGAAAACTTCATTTGCTTGGCATACTGAGGACATGGATCTCTACAGT
ATTAATTACCTGCATTTTGGGGAGCCTAAGTCATGGTACTCTATCCCTCCAGAGCATGGCAAGCGACTGGAGAGACTTG
CCAAAGGATTCTTTCCGGGAAGCGCCCAGAGCTGCGAAGCGTTTCTCCGTCACAAGATGACCTTGATCTCTCCATCAAT
TCTGAAGAAATATGGCATCCCATTTGATAAGGTGACGCAGGAGGCAGGAGAGTTCATGATAACTTTTCCTTATAGTTAT
CATGCTGGCTTTAATCATGGATTTAACTGTGCTGAATCCACCAACTTTGCCACTCTTCGGTGGATTGAGTATGGGAAGC
AGTCTGTACTGTGCTCGTGTCGGAAGGACATGGTGAAGATCTCCATGGATGTGTTTGTGAGGAAGTACCAGCCAGACCG
TTACAAGCTTTGGAAAGCTGGGAAGGATGTGACTGTCATTGACCATGCTCTTCCAACACCAGAAGCAGCTGAGTTCCTT
AAAGGGGATCTCATGCAAAAGGTCAAGAGTGGGAGGCAATATGCTGAGGATATGGAAACAGGAGAAGCATGTAAAGAGG
AAGTGGACGGGGATGAGACAAAAAGTGTGCCCAAGCATCGCATAGGAACAAAAAGGCACAGAGTGTGCCTGGAAGTACC
TCAGGAAGTGAGTGAGAGTGAGGCCTTCCCCAAAGAGGAGCTGAGCTCTATGCAGGACGAAGAAGATGCTGCAGAACCC
TGCGAGAGAGCTACGGGAGAAGTTACGCAGCAGAGTGAACAGGGGCACAAGGTTCCAGATCGTGTGGGCATGGCTAAAT
CTGAAGAACTGAAAGTGGTGAAGCTTGAGGAGGAAGAAGAGGAAGAGCAAGAGGCCGCCGTGTTGGATCTTTCCATTTC
GCATGCTTCAAATTCTGCTTCAGTTTTGCCAACCTCAAAGCAGAGAGCACCTTCCAGTGTTCAGCCCAGCTCACCAGCA
TATTCTGGGTCTTCAGACTCTGAGTCAACTGATCTGTTGCCAAAAAGAACTCTACCTGGGCCAGCTGGGGTGCTTACAG
TCCATAGCTATGCTAGAGGGGACGCCAGCGGATCTGACAATGAAACTTCAGGAAAGAAAGCCAGTGCTACAGGCAGCGT
GAATGAACAAGAACTGGCAGAGGTAACAAAGGAGTACATACAATCAATGAAGGAAAGTAAGAAGTCCAAGGGTCGTCGC
CAGCCATTGAGTAAGCTCCCACGCCACCACCCACTCTTGGTTAAAGACTGCATTAGTGATGATGAGGCATCAGAGCAAC
TAACTCCTGAAGAAGAAGCTGAGGAGACAGAAGCTTGGGCCAAGCCACTTAGCCAGCTCTGGCAGAATCGACCACCAAA
TTTTGAGGCTGAAAAAGAGTATAATCGGACCATGGCTCAGCAGTCTCCTTACTGTGCTGTTTGCATGCTCTTCCAGACG
TATCAGGCAGAGTGTGGAGGCAGCAGTCAGAACTCTGGAGGAACTCCGGGTGCCGCGGATGGGAAGATCCGAACCAAGC
CCCTGATTCCTGAAATGTGCTTTACTACAACTGGCTGCAGCACTGATCTCAATCTTTCAACCCCTTACTTAGAGGAAGA
TGGAACCAGCGTACTCATCACCTGCAGGAACTGCCAAGTCTGTGTTCATGCAAGTTGTTACGGTGTATCCCCTGACAAG
GCCACCGAAGACTGGATGTGCTCCAGGTGTACAGAAAATGCCTTAGAAGAGGACTGCTGTTTGTGTTCATTACGAGGAG
GAGCACTGCAGAGAGCCAACGATGACAAATGGGTTCACGTCATGTGTGCTGTAGGTGTACTGGAAGCAAAATTTGTGAA
CATTGCAGAACGCAGCCCTGTGGATGTCAGCAAGATCCCCCTGCAACGCTTCAGACTGAAATGCATCTTCTGCAAAAAA
CGAAGGAAGAGAATCGCAGGTTGCTGTGTACAGTGCTCCCATGGTCGGTGTCCCACGTCCTTCCATGTCAGCTGTGCCC
AAGCAGCAGGAGTTATGATGCAGCCTGATGACTGGCCATTTGTTGTCTTCATTACCTGCTTCAGGCATAAGATCCCATC
TCAGGCAGAGCGAGCTAAGGCTGCACTCCAAGATCTGTCACCTGGGCAGATAGTCATCAGCAAGCACAAGAATGGTCGC
TTCTATCAATGTGAAGTGGTCAGCCTCGCAAAAGAGACTTTCTACGAGGTCAACTTTGATGATGGTTCCTTCAGTGATA
ACCTGTATCCAGAGGACATTGTGAGTCGAGACTGTCTTCAGTTGGGTCCACCAGCTGAAGGTGAAGTTGTGCAGGTCAG
ATGGACAGATGGACAGGTTTACGGAGCCAAGTTCGTTGCATCACATGCCATCCAGATGTACCAGGTGGAATTTGAGGAT
GGGTCACAGCTGATGGTGAAAAGGGATGATGTGTACACTTTGGAAGAGGAGCTTCCTAAGAGAGTCAAGTCAAGGCTGT
CAATAGCTTCAGATATGCGCTTCACAGAGATCTTCGCAGAGAAGGAGGTCAGGCAAGAGAGGAAGAGACAAAGAGTGAT
CAATTCACGCTACCGGGAAGATTACATTGAACCTGCCTTGTACCGGGCCATCATGGAGTAAGCACTGCCTGTGGCAGAG
GAAGAAGATGCCCACCTCCCCCTAGGATTTAAACGCTCCAGTACAACAGGCCATATTTGGATGCTTCCAAATCCAGGGT
TTTTTTTGTTTTGTTTTGTTTTTTAAAAGAAGTTATAAAGCTGATGCTCTGCAGTAGCTGAAAGGCAGCTGTTGGATAG
TGAAACAGATCCCATTTGCTGAAGCTGTTGCCTGCGGCCTCCTGGTCTGAAGTTGGGTCTTTACTGAATAAGCCAGCTT
GGGAGGGTGCTGCTTTCATCTCGTTGAGCCATCTTGCTTTTCTTTTAAAGACTATTTTGACAGGTGGAAAACTCTTCTG
GGAGTTGTAGCCAGGAATCTCGGCAGCTGCAGAATAGCAAAAAGTTTGTTTTAATCGAATAATGTTCCTGATTTTGAGA
GTCTCCCTGGTGGCTACACCTGGGCTTGAGCAGGCAGTATTACTGGTGCTTGATATTGAACCTCTTTTTATATTTATAT
CCTTTTTTTTTTGTTGTTGGTTTTTTTTTTTGTAAGCAGCTTCAGACTCTTTGTTTCTCAGCACCTTCTTTCTGATGGT
TGAGCTGTAGGCTGTTCAGATCCAAGCAGACAGGAGGTGCTCGTGTGAACAGGTGAAATGTGAAACTGAACCTATTGGA
CAGATTATTTAACCATTTAATATTTTTGTTCCAATGCTCGTTTTGATTTAATTACTCTTAACTACATGTGCCTCAGTAT
AAAAAAAAAAAAAGAAAAAGAGAAAGAAAATCTGTCTGGAGCCCTGCACAGTGCAGCCTTCTAACCAGATTAAGCATTT
ACCTCCCAATTGGTATTCAGCACCCAAGAGTTTCTTCTGAGTTTCTTCCCACTCCAACTAATGCAATAATGAACAAAGG
GATGGAGTTCTAACTCTTCCCCTTTGAAATCCAAGCATCACAGTATTGAGTATGACAAGGCAGCGGCACCTGAAGGAGT
GCTGCACCTCTTCTGTGGCAGCACTGCCCTTTGTGTAGCCCCAAGACGTTGGGTTTGTGACAGATCAAGCATGCACTGA
ACTGTATTACTGAGGAGCTGTGCAGTGCTCTTCTCAAGGAGGAGTGCTGCCACATTACTGTCTAGCAAGGGTTACCACA
GCGTGTTTATAAAGCCTAAGTTGGGCACGTCTCAGTTGTGTTGGTGAGTACTTGCTACCTCAGCAGTAGGAACGTGAAT
AAAGCTGGGTGGTAAGTGCACCTTGAAGGTGTGCCAGCTTGCTCCGAGCAATCTAAGCATTAACACGCCACACAGGAGC
CATGTAAATATTTGTTCCTTTCCCATTCTGTAGGAAAGGGATTTGGGGCTGTGGAGCAGATAGGCCACCTTCCTTTTTG
CATAGGATGACGGGATGACTTTTCTGCTGAAGAAAAATACAGTGACGTTCTCCAGAAGTAGCTCAAGAGGAGAATTTTC
TAGTGAAACAGACCTAATGCATCCCTGCTTCTATAGGGACATAGCAGTGTGTCTGCAAAAACTGGGTTTGTAACTTTTT
TTTCCTTTTCTTACATAGGAACGCTATAAACCAAACTGTTCTGAAATCCTGGTGCGTCAGTCTGTGATTAGCAATAAAA
TGTAGTCTTGTGTAGTGATACAGCTCTTGACCAGAAAAGAAATAAACTACAACTTTTATAAGGAAAATC
CitationStrobl-Mazzulla PH, Sauka-Spengler T, Bronner-Fraser M. Histone demethylase JmjD2A regulates neural crest specification. Dev Cell. 2010 Sep 14;19(3):460-8.
CopyrightCopyright © 2010 Elsevier Inc. All rights reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
  
4-6
stage 4
stage 5
stage 6
stage 6
Epiblast
Neural Plate/Tube
 
7-10
stage 7
stage 7
stage 8
stage 10
Epiblast
Neural Crest
Neural Plate/Tube
maybe E'

Mouse

EmageMGI:2446210
EurexpressMGI:2446210
MGI GXDMGI:2446210

Frog

Xenbase1010380

Fruit Fly

BDGPFBgn0033233

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-6279, ZDB-GENE-110609-4
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona