GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KAZALD1
Kazal type serine peptidase inhibitor domain 1

Gene
Official SymbolKAZALD1
Official Full NameKazal type serine peptidase inhibitor domain 1
CGNC ID5927
also known askazal-type serine protease inhibitor domain-containing protein 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_421724
PolypeptideXP_421724
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human81621MIM:609208
Mouse107250ENSMUSG00000025213All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:2147606
Xenopus100101767, 443968486703
Zebrafish100000101ENSDARG00000053509ZDB-GENE-050208-155ZFIN:ZDB-GENE-050208-155
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene423856
Ensembl Gene
KEGGgga:423856

Entry 1

GEISHA IdKAZALD1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
TGGGATGTGCCAACCTGGAGGGACAGATCTGCGACCTGGACAACACCAACCACTTCTATGGCAAATGCGGGGAGCACCT
GGAGTGCCAGCTGGAGGCTGGAGACCTGCAGCGTGGCGAGGTGCCCGAGCCCCAGTGTGCCTGCATCTCGCACCAGGCG
CTGTGCGGCTCCGACGGGCGCACCTACCCACAGATCTGCCGCTTCCTCGAGTCTGCCCGTGCCCACCCCGATGCCAACC
TCACCGTGGCCCACGAAGGTCCCTGCGAGGCAGAGCCTCAGATCACCTCCCCTCCTTATGATGCGTGGAATGTCACTGG
CCAGGATGTCATCTTCGGCTGCGAGGTCTTTGCCTACCCCAANGGCNGTCCATCGAAGTGGAGGGAAGGNATG
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST70d11. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Aorta
Atria
Ear/Otic Placode
Ectoderm
Endoderm
Extraembryonic Blood Vessels
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Myocardium
Notochord
Outflow Tract
Pharynx
Sclerotome
Sinus Venosus
Somatic Mesoderm
Somites
Splanchnic Mesoderm
Ventricles
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
section 16
section 28
section 42; rostral dorsal mesocardium
section 53
section 7
section 70

Entry 2

GEISHA IdKAZALD1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TTGGGAATGTGCCAACCTGGAGGGACAGATCTGCGACCTGGACAACACCAACCACTTCTATGGCAAATGCGGGGAGCAC
CTGGAGTGCCAGCTGGAGGCTGGAGACCTGCAGCGTGGCGAGGTGCCCGAGCCCCAGTGTGCCTGCATCTCGCACCAGG
CGCTGTGCGGCTCCGACGGGCGCACCTACCCACAGATCTGCCGCTTCCTCGAGTCTGCCCGTGCCCACCCCGATGCCAA
CCTCACCGTGGCCCACGAAGGTCCCTGCGAGGCAGAGCCTCAGATCACCTCCCCTCCTTATGATGCGTGGAATGTCACT
GGCCAGGATGTCATCTTCGGCTGCGAGGTCTTTGCCTACCCCATGGCGTCCATCGAGTGGAGGAAGGATGGCACAGAGA
TGCTGCTGCCGGGAGATGACCCCCACATCTCTGTCCAGTTCAGAGGTGGCCCCCAGAAGTACGAGGTGACCGGCTGGCT
GCAGATCCAGGGCGTGCGGGTGACGGACGAGGGCACGTACCGCTGCTTTGCCAGGAACAGGGTTGGGGCTGTGGTGGCA
GTGGCCAGCCTGACCGTCCTCACTCCGGACCAACTCAACCTGACGGGCTTGTCCCTGCTGGAACCCCGTGCCGTGCCTG
AGGACTACGGAGACAGCGAGGAGGAGTACTACTAGCTCAGCTGCGGAGCTTGGCACTGGGCAGCGCTCACCCCATTGTG
CTTTGGGGTCAGGGCATGGATCCCAGAGCAAACACCCCCAGCCCTGAACTCCTCTCTGAACACCTCTCTTTTGGGGCTG
GGGACACGATGACACTGCGGCCTGGTGTGTCACCCCTCAGGCAGGACGTCCAGGAACCTTGCTGCCAAAACGCCCTTCT
TTCCCATTTTGTTTTTAACCAGAAAAGTAATGTTCTGAGGGCAACCCTGACATTGGTGGTTTCACCCCCGGATGATGTG
GTCCTGAAGTCCAATCGGCCCA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 

Mouse

Emage
EurexpressMGI:2147606
MGI GXDMGI:2147606

Frog

Xenbase486703

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050208-155
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona