GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF11
kinesin family member 11

Gene
Official SymbolKIF11
Official Full Namekinesin family member 11
CGNC ID5124
also known askinesin-like protein KIF11
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001031230
PolypeptideNP_001026401
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.48266
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly38135FBgn0004378
Human3832ENSG00000138160MIM:148760
Mouse16551ENSMUSG00000012443All phenotypic alleles (4):Targeted, knock-out(1) Targeted, other(2) Gene trapped(1) MGI:1098231
Xenopus548870, 379112, 397908978998
Zebrafish195818ENSDARG00000010948ZDB-GENE-020426-1ZFIN:ZDB-GENE-020426-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene423809
Ensembl Gene
KEGGgga:423809
GEISHA IdKIF11.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerATTCCAGCCGTTCCCACTC
Reverse cDNA Template PrimerGCAACTTGCTAGCTGTGCCcDNA Template Length807
Complete cDNA Template Probeshow
ATTCCAGCCGTTCCCACTCCGTATTCTCAATCACCATCCATATGAAAGAAACCACAGTAGATGGAGAAGAACTCGTTAA
AATTGGGAAGCTAAACTTGGTTGATCTTGCAGGAAGTGAGAACATTGGTCGATCTGGGGCAGTTGACAAAAGAGCTCGT
GAAGCTGGAAATATTAACCAGTCTCTCCTGACTCTGGGAAGAGTTATTTCTGCTCTAGTAGAAAGAGCCCCACATATTC
CATACAGGGAATCCAAACTCACAAGAATCCTTCAAGATTCTCTTGGAGGACGAACAAAAACATCAATAATTGCAACAGT
TTCTCCTGCATCTATAAATCTTGAGGAAACACTGAGTACACTAGAATATGCCCACAGGGCAAAGCACATAATGAACAAG
CCTGAAGTTAACCAGAAGCTGACCAAAAAAGCTCTTATTAAGGAATATACTGAAGAGATTGAGCGTTTGAAAAGAGACC
TTGCTGCTACACGTGAGAAGAATGGAGTCTATATTTCCCTTGAGAATTTTGAAGCCCTTAATGGAAAGCTGACGGTTCA
GGAAGAACAAATTGCAGAGTATATTGACAAAATCAGTGTCATGGAGGAAGAGATGAAAAGAGTAACTGAACTGTTCACT
GTTAATAAAAATGAACTTAAGCAGTGTAAAACAGATCTGGAAATCAAGGAGAAGGAGCTGGAAGAAACACAGAAAGATC
TGCAAGAAACCAAAGTTCATCTGGCTGAAGAAGAATATGTGGTTTCTGTTTTGGAAAATGCTGAACAAAAACTTCATGG
CACAGCTAGCAAGTTGC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Epiblast
Primitive Streak
 
7-12
stage 8
stage 9
stage 12
Aorta
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Midbrain
Neural Plate/Tube
Somites
 
19
stage 19
stage 19
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.48266

Mouse

EmageMGI:1098231
EurexpressMGI:1098231
MGI GXDMGI:1098231

Frog

Xenbase978998

Fruit Fly

BDGPFBgn0004378

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020426-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona