GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF12
kinesin family member 12

Gene
Official SymbolKIF12
Official Full Namekinesin family member 12
CGNC ID2607
also known askinesin-like protein KIF12
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_425403
PolypeptideXP_425403
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly47216FBgn0263076
Human113220ENSG00000136883MIM:611278
Mouse16552ENSMUSG00000028357All phenotypic alleles (4):Targeted, knock-out(1) Targeted, other(3) MGI:1098232
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene427829
Ensembl Gene
KEGGgga:427829
GEISHA IdKIF12.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGCACCAATGCCATCGTGTC
Reverse cDNA Template PrimerTGTGGAGCTGGCTGAACAGcDNA Template Length867
Complete cDNA Template Probeshow
GCACCAATGCCATCGTGTCCCAGGTAGGGTCAGTCCCATTGCAGAGCATGGCAGGATGTGGGGGCAACCTGATGGCTCC
GCTTGGCCCCCACATACTGCCAGTCCCCAACAAGGGAAGTGCCAGCCTCCCGCTGCCCGCCCAGGACAATGTCACCGTG
CCCAGCTGTTGGCTGCAGAAGGGAAAGTGGAGCCAGGGCAGGAGCTGGTGCTCCCTGCGGCAGCACACAGTGCCACAGG
ATAGCCAGGAGGCAACGGGCACTGACGGAAGGGTCGTCCCTTCAGCCCCACCATGGCCAGGACCACCAGAGCCCAGAGC
TGCCGGACCCGTCCCTGTGCTGCAGTGGGAAGAGGCCTCGGAGTGGCTGGCGGAGCAAATCTGAGCACTGCCCTCACAC
CGTGATAGGGACACTTTGGGGACAACGACGTGCGACAGTGACTGCACAACACACAGACCTCACCCTGATGGACAGACAG
ATGGACACAGCGCTGGCGGTTTATTTGGGTCTAGCTAGGTGCCGTGCTGCTGGTGGCCCTGGGGGGGCCTGTTCAGGTG
CTCTCCTCATCGGGCTGCGGGCAGTCCAACCAGTACTGCGCGATGGAGCGCGGGTAGGGGGGCTGCACCAGATCCACGC
GCTTGGTGCGCAGGTTGACGCGGTAATACTTGTCTGGGGGGGGACAGAAGGAGCTGTCAGACCTCACTGCCAGCCCCGC
GCTGTCCCAAAGCATCCCCAGCCCCAGGGGGCAACTCTCCCCCAGACTCACCCCCTACGAAGAAGTAGACGCTCTGTAG
GGTCTCA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 9
stage 11
Extraembryonic
Neural Plate/Tube
Unlabeled
 
13-17
stage 17
Head Mesenchyme
Pharyngeal Arches and Clefts
 

Mouse

Emage
EurexpressMGI:1098232
MGI GXDMGI:1098232

Frog

Xenbase

Fruit Fly

BDGPFBgn0263076

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona