GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF13B
kinesin family member 13B

Gene
Official SymbolKIF13B
Official Full Namekinesin family member 13B
CGNC ID12468
also known askinesin-like protein KIF13B
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_003641072
PolypeptideXP_003641120
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.12069
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene422026
Ensembl Gene
KEGGgga:422026
GEISHA IdKIF13B.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerACAAGCAGAGTGGTGACCG
Reverse cDNA Template PrimerTTGCGCAACACCAAGTGCcDNA Template Length946
Complete cDNA Template Probeshow
ACAAGCAGAGTGGTGACCGCAAAAATCCAACCCTGTGGGATTTGGGAATCATTCAGGCCAAAACACGGAGCCTTCGAGA
CAGGTGGAGTGAAGTGACCCGAAAAGTAGAGCTCTGGGTTCAAATTCTAGAGCTGAATGAGAATGGGGAATACTGCCCA
GTTGAGGTGACTCCAGCCAAGGATGTTTGCACTGGAGGCATCTTTCAGCTCAGACAGGGGCAATCTCGAAGAATTCAGG
TTGAAGTGAGATCTGTGCAGGAATCTGGGACCTTGCCACTGATGGAGGAGTCAATTCTATCTGTTGGAATTGGCTGTGT
TCAAATAAAACACGTTAAGTCACAAAAAGTACCTGAGATTTATCAGGAAGAAGAGGATGAAATGGACAGTTACCAGGAT
AGGGATTTGGAGAGGCTCCGTCGGAAGTGGCTGTGTGCCTTAACAAAGCGGCAGGAATACCTTGATCAGCAACTGCAGA
AACTCGTTGGGAAGCCTGATAAAACAGAGGATGATGCTGATCGGGAGGCACAGCTTCTAGAGATGAGGCTAACGCTCAC
TGAAGAAAGGAACGCTGTAATGGTGCCTTCTGCAGGCAGTGGGATCCCTGGAGCTCCAGCAGAGTGGACTCCCGTGCCT
GGTATGGAAACTCACATTCCTGTTATTTTCCTTGACTTGAATGCTGATGACTTTAGCTCCCAAGATAACCTTGATGACT
CAGAAGCAGGTGGGTGGGATGCGACTCTTGTTGCTGAAGAAGAGGAGGAATTTTTTGAACTGCAGATTGTAAAACATCA
TGATAGCGAGGTGAAAGTAGAAGCCTCCTGGGATTCCACAGTCCACGACTGCATCCAGCTCAGTAAAGGAACAGCAGCA
GATGAAAGAGTTTACCTTATTGTGAGAGCCACTGTGCAGCTCAGCCATCCTGCAGAAATGCACTTGGTGTTGCGCAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Unlabeled
 
7-12
stage 8
stage 9
Extraembryonic
Neural Plate/Tube
 
13-18
stage 14
stage 16
Foregut
Head Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
 
19
stage 19
Foregut
Head Mesenchyme
Leg Mesenchyme
Pharyngeal Arches and Clefts
Sclerotome
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.12069

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona