GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF14
kinesin family member 14

Gene
Official SymbolKIF14
Official Full Namekinesin family member 14
CGNC ID1552
also known askinesin-like protein KIF14
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_422190
PolypeptideXP_422190
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly35293FBgn0004374
Human9928ENSG00000118193MIM:611279
Mouse381293ENSMUSG00000041498MGI:1098226
Xenopus1001450325889658
Zebrafish562052ENSDARG00000062187ZDB-GENE-030131-5759ZFIN:ZDB-GENE-030131-5759
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene424347
Ensembl Gene
KEGGgga:424347
GEISHA IdKIF14.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerACTTGGCATCAGGTGGTGG
Reverse cDNA Template PrimerATCCTTCTCAGCGCTGTCGcDNA Template Length722
Complete cDNA Template Probeshow
ACTTGGCATCAGGTGGTGGGCAGCCTGATAAAAATACACCCCAGGGCACGGAGAGTACGCAAATGGAGAAAAGGCTTAC
CCTGCAGAGGCGTGTGAAGAGTGGCTCTGTGGAAAAGAGTACAATCAATGGGAGTACTGTGCCTGGAGCAGAAAACAGT
GTCTTTGATGCAGAGAGAAAATACAAGATTGCACTTCAACCCAGTATTAGTAATAATGATACCCATTATATTAAATCAA
GCTGTAAGTTAGCTGAGGGTCAACAAGTTATCAACTTGAATTCTAAGTTCCATAGCAAGGATGTGTTTGGCAACGTTGA
AAACGATGACTGTGTGCACTCTAAATGTAGGATGGACGCTGCTGATGCCAGATTTCCAAAGGAAGTTCCTGTATCAGAA
CAGCTGGCTACCTCAAAGTATGTTAATCAGGTATCAGGAGAGCAGCTGCATGAAAAAGGTGATATCAAAAGAATGGCTG
GAAAGCAAAGGTTACAGCAGTTAAAGTATAACAGCTTGGAAAGACCAAGGACACCAACAAAAGCTTCCACAGAAGGATT
TAAGCTTACGCCAAAGAACAGCACTTTTCAGGTGAAGTCATCTCTATCTGCTTCAAGTAAACAAACAGCTGATCTTCCA
ACTGTGTCAGAAAAGAAAACAAGCTCCTCTCCTGGGGGTAGAAGTGCAAAAGCAGATGAGGATGCTGAAAGCGACAGCG
CTGAGAAGGAT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Early Mesoderm
Epiblast
Primitive Streak
 
7-12
stage 8
stage 10
Amnion
Anterior Intestinal Portal
Forebrain
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
extraembryonic mesoderm
 
13-18
stage 13
stage 18
stage 18
Amnion
Anterior Intestinal Portal
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Somites
Ventricles
Widespread Expression
extraembryonic mesoderm
 

Mouse

EmageMGI:1098226
EurexpressMGI:1098226
MGI GXDMGI:1098226

Frog

Xenbase5889658

Fruit Fly

BDGPFBgn0004374

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-5759
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona