GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KLF2
Kruppel like factor 2

Gene
Official SymbolKLF2
Official Full NameKruppel like factor 2
CGNC ID2890
also known asKrueppel-like factor 2|Kruppel-like factor 2 (lung), KLF2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418264
PolypeptideXP_418264
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.7528
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10365ENSG00000127528MIM:602016
Mouse16598ENSMUSG00000055148All phenotypic alleles (6):Targeted, knock-out(3) Targeted, other(3) MGI:1342772
Xenopus549518, 380122485034
Zebrafish117508, 117509ENSDARG00000042667, ENSDARG00000040432ZDB-GENE-011109-1, ZDB-GENE-011109-2ZFIN:ZDB-GENE-011109-1, ZFIN:ZDB-GENE-011109-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420148
Ensembl GeneENSGALG00000003939
KEGGgga:420148

Entry 1

GEISHA Idpgp1n.pk010.g3Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CGCACCATGGCGCTGAGCGATACCATCCTGCCCTCCTTCGCCACCTTCGCCAGTCCCTGCCGCGAGAAAGCGCTCCACG
AAAGGTGGAAGTGCGAGCAGGAGGCCAAGGCCCCCGGCGGCACCTGGGGCGACCTCTCCCCACGCAAAGAGGATGAAGA
CCTCAACAACGTGCTGGATTTTATCCTTTCCATGGGCAGCGACGGCTACGGCCAAGGGGCTGCCGGCGGGGACTATCCC
CCCGCGCAAGGGGAGAGCGGAGGCTTCTACCAGACAAACCCGAACCCGGGATGCTACAGTGCCCTGGAGCAGGGCAGCC
CCCCGCCCTACAGCGCCGGCATCGCTCCCGAGATGATCCGCCCTGAGATGGACTCCAACTACTGCCCGGCCGGCAGCGT
GCACGGGCGCTTCTTCGTGACGCCCAGCTTCGGGGCTCCGCAGTTCGTGGACAGCATCAAGCCCGAGCCCGACATGGAC
AGTTATGGGCCAGTCCTGGGTCTGGTGCCCCAGGCTTGCCCGAAGATCAAGCAGGAGGGCAGCGCGACCTGCATGATGG
CCTACGAGCAGCCGCGGGTGGCCAACTCCCCACAGATCCCCGGCGCCGAAACACCACCGCTGAGCCCCGACGATCTCAT
GGTGAATGACTGCCACACGCAGATGATGTGCCCCTCGTCCGTGTCCTTCCAGCAGAGCTACCACCCGCCCTCCGGCTTC
CACCACCCGCAGACCCACCTCCAGTACCAGAACACCTCCCAGTACGGCCTTTTCGAGGACAGCCTGCCCCTCCAGCCCT
CCGCTCCCCGGGGTAT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 9
stage 10
stage 11
stage 11
stage 12
stage 12
stage 12
Aorta
Arteries
Blood Vessels
Cardinal Veins
Endocardium
Midbrain
Neural Plate/Tube
Outflow Tract
Sinus Venosus
Somites
Veins
Yolk Sack or Stalk
 
13-18
stage 13
stage 14
stage 14
stage 14
stage 14
stage 14
stage 15
stage 15
stage 15
stage 15
stage 17
stage 17
stage 17
Blood Vessels
Endocardium
Intermediate Mesoderm
Valves
Yolk Sack or Stalk
 
19-24
stage 19
stage 19
stage 19
stage 19
stage 20
stage 21
stage 21
stage 22
stage 22
stage 22
stage 22
stage 22
stage 23
stage 23
stage 23
stage 24
stage 24
stage 24
Allantois
Blood Vessels
Endocardium
Leg
Leg Mesenchyme
Limb Buds
Valves
 
25-26
stage 25
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
Blood Vessels
Endocardium
Leg Bones
Leg Mesenchyme
Wing
Wing Bones
Wing Mesenchyme
Hip

Entry 2

GEISHA IdKLF2.Antin.2010Data SourcePublication
Complete cDNA Template Probeshow
CGCACCATGGCGCTGAGCGATACCATCCTGCCCTCCTTCGCCACCTTCGCCAGTCCCTGCCGCGAGAAAGCGCTCCACG
AAAGGTGGAAGTGCGAGCAGGAGGCCAAGGCCCCCGGCGGCACCTGGGGCGACCTCTCCCCACGCAAAGAGGATGAAGA
CCTCAACAACGTGCTGGATTTTATCCTTTCCATGGGCAGCGACGGCTACGGCCAAGGGGCTGCCGGCGGGGACTATCCC
CCCGCGCAAGGGGAGAGCGGAGGCTTCTACCAGACAAACCCGAACCCGGGATGCTACAGTGCCCTGGAGCAGGGCAGCC
CCCCGCCCTACAGCGCCGGCATCGCTCCCGAGATGATCCGCCCTGAGATGGACTCCAACTACTGCCCGGCCGGCAGCGT
GCACGGGCGCTTCTTCGTGACGCCCAGCTTCGGGGCTCCGCAGTTCGTGGACAGCATCAAGCCCGAGCCCGACATGGAC
AGTTATGGGCCAGTCCTGGGTCTGGTGCCCCAGGCTTGCCCGAAGATCAAGCAGGAGGGCAGCGCGACCTGCATGATGG
CCTACGAGCAGCCGCGGGTGGNNNACTCCCCACAGATCCCCGGCGCCGAAACACCACCGCTGAGCCCCGACGATCTCAT
GGGTGAATGACTGCCACACGCNNNTGATGTGCCCCTCGTCNG
CitationAntin PB, Pier M, Sesepasara T, Yatskievych TA, Darnell DK. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family. Dev Dyn. 2010 Jun;239(6):1879-87.
CopyrightCopyright © 2010 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAuthors indicated the probe was made from pgp1n.pk010.g3, which is NCBI acc. # BI393186.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Blood Vessels
Endocardium
 
13-18
stage 13
stage 16
stage 16
stage 16
Aorta
Atria
Blood Vessels
Endocardium
Outflow Tract
Valves
Ventricles
 
19-24
stage 20
stage 24
Allantois
Blood Vessels
Endocardium
Head Mesenchyme
Heart Tube
Leg
 

Entry 3

GEISHA IdKLF2.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
CGCACCATGGCGCTGAGCGATACCATCCTGCCCTCCTTCGCCACCTTCGCCAGTCCCTGCCGCGAGAAAGCGCTCCACG
AAAGGTGGAAGTGCGAGCAGGAGGCCAAGGCCCCCGGCGGCACCTGGGGCGACCTCTCCCCACGCAAAGAGGATGAAGA
CCTCAACAACGTGCTGGATTTTATCCTTTCCATGGGCAGCGACGGCTACGGCCAAGGGGCTGCCGGCGGGGACTATCCC
CCCGCGCAAGGGGAGAGCGGAGGCTTCTACCAGACAAACCCGAACCCGGGATGCTACAGTGCCCTGGAGCAGGGCAGCC
CCCCGCCCTACAGCGCCGGCATCGCTCCCGAGATGATCCGCCCTGAGATGGACTCCAACTACTGCCCGGCCGGCAGCGT
GCACGGGCGCTTCTTCGTGACGCCCAGCTTCGGGGCTCCGCAGTTCGTGGACAGCATCAAGCCCGAGCCCGACATGGAC
AGTTATGGGCCAGTCCTGGGTCTGGTGCCCCAGGCTTGCCCGAAGATCAAGCAGGAGGGCAGCGCGACCTGCATGATGG
CCTACGAGCAGCCGCGGGTGGNNNACTCCCCACAGATCCCCGGCGCCGAAACACCACCGCTGAGCCCCGACGATCTCAT
GGGTGAATGACTGCCACACGCNNNTGATGTGCCCCTCGTCNG
CommentsImages provided by Claire Anderson. The probe was synthesized from cDNA clone pgp1n.pk010.g3 (NCBI acc. # BI393186.1). Reference paper for the probe: Antin PB, Pier M, Sesepasara T, Yatskievych TA, Darnell DK. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family. Dev Dyn. 2010 Jun;239(6):1879-87.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
Atria
Endocardium
Extraembryonic Blood Vessels
Myocardium
Outflow Tract
Ventricles
section 11
section 28
section 39
section 65
ventral view

Entry 4

GEISHA IdKLF2.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GCGTCCCGCCCGGCCGCACCATGGCGCTGAGCGATACCATCCTGCCCTCCTTCGCCACCTTCGCCAGTCCCTGCCGCGA
GAAAGCGCTCCACGAAAGGTGGAAGTGCGAGCAGGAGGCCAAGGCCCCCGGCGGCACCTGGGGCGACCTCTCCCCACGC
AAAGAGGATGAAGACCTCAACAACGTGCTGGATTTTATCCTTTCCATGGGCAGCGACGGCTACGGCCAAGGGGCTGCCG
GCGGGGACTATCCCCCCGCGCAAGGGGAGAGCGGAGGCTTCTACCAGACAAACCCGAACCCGGGATGCTACAGTGCCCT
GGAGCAGGGCAGCCCCCCGCCCTACAGCGCCGGCATCGCTCCCGAGATGATCCGCCCTGAGATGGACTCCAACTACTGC
CCGGCCGGCAGCGTGCACGGGCGCTTCTTCGTGACGCCCAGCTTCGGGGCTCCGCAGTTCGTGGACAGCATCAAGCCCG
AGCCCGACATGGACAGTTATGGGCCAGTCCTGGGTCTGGTGCCCCAGGCTTGCCCGAAGATCAAGCAGGAGGGCAGCGC
GACCTGCATGATGGCCTACGAGCAGCCGCGGGTGGCCAACTCCCCACAGATCCCCGGCGCCGAAACACCACCGCTGAGC
CCCGACGATCTCATGGTGAATGACTGCCACACGCAGATGATGTGCCCCTCGTCCGTGTCCTTCCAGCAGAGCTACCACC
CGCCCTCCGGCTTCCACCACCCGCAGACCCACCTCCAGTACCAGAACACCTCCCAGTACGGCCTTTTCGAGGACAGCCT
GCCCCTCCAGCCCTCCGCTCCCCGGGGTATGCTCACCCCTCCTTCCTCCCCGCTGGAGCTGCTGGACTCCAAGCCGAAA
CGAGGCCGGCGCTCCTGGCCCCGCAAGAGGACGGCCACGCACACGTGCACGTACGCGGGCTGCGGGAAGACCTACACCA
AGAGCTCCCACCTGAAGGCCCACCTGCGGACACACACAGGTGAGAAGCCGTACCACTGCAACTGGGAGGGCTGCGGCTG
GAAGTTCGCCCGCTCCGACGAGCTCACCCGCCACTACCGCAAGCACACCGGGCACCGGCCCTTCCAGTGCCACCTCTGC
GACCGGGCCTTCTCCAGGTCGGACCACCTGGCCCTGCACATGAAGCGGCACATGTAGCCGCGGGGCCCACCGGACAGTG
CCCGTTGTGAGCTGCTCAGGTGCAGGACGCTCCGAACCTGTAGCTGGTACTACGTGGGGAGGCGCCGGCGCTCCGGCCG
CCGAGGATTGGACACAGGGAGGCCCAGCAGTCGTCTCCTGCACAGAACCTGACGAGGCGGCGTCCGCGAATCTGCCCGC
GCCGGGCGGGGAGGACGGGGGGTTATTTATGCAGCTTCTGTGAAGGGTGAACTCCGTGAGGCTCCACACGGATTGTATA
GAAGAAGCTGTAAATATCGTTTTTTCTGTTCCGGCTCTAACTGCCCCAAGCTTAACGAGACAATGTTTGTATGGAAACT
GCCTGAAGTTGACCCTAGGAGAGATTAAGTGAGCGTTGCTGTAGCTCGGTGTTATTTTAGATCTTGGCTGAAGGCATGG
CTAAGAGAACACTCCTATTGTTAGACTGTCTGTTTCACAGGTGCAATAATACTCATGTTTGCCATGATCTACACTAGAA
ATACAGGGCTTGACGTCTTGTAAGAAAATAACCTATTTTACTGTAATTTTTTTTATATATTGTAAATAATTTTATACAG
CGAGAAATATTGTATATGTAAATAGAAGACAAATGGGTATTTTGCCTATTTCTGGTTTTATAAAAACGTGGTTTTTTCA
ATGTTTGAAAACATTTCATCTTTTTAATAAAACAAGTTTTTAATTGC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001318423)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Endocardium
Outflow Tract
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.7528

Mouse

EmageMGI:1342772
EurexpressMGI:1342772
MGI GXDMGI:1342772

Frog

Xenbase485034

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-011109-1, ZDB-GENE-011109-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona