GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KLF4
Kruppel like factor 4

Gene
Official SymbolKLF4
Official Full NameKruppel like factor 4
CGNC ID28582
also known asKrueppel-like factor 4|Kruppel-like factor 4 (gut)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_001233583
PolypeptideXP_001233584
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.38576
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human9314ENSG00000136826MIM:602253
Mouse16600ENSMUSG00000003032All phenotypic alleles (4):Targeted, knock-out(3) Targeted, other(1) MGI:1342287
Xenopus550034, 3795181015048
Zebrafish562155, 65238ENSDARG00000038792ZDB-GENE-111014-1, ZDB-GENE-010129-1ZFIN:ZDB-GENE-111014-1, ZFIN:ZDB-GENE-010129-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene770254
Ensembl Gene
KEGGgga:770254

Entry 1

GEISHA IdChEST913e4Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CCCGGCTACCCGACCTTCCTGCCCGAGCAGCTGCCCCCCGGCACGCTGCAGTACCAAGAGCTGATGCCGCCGGGGAGCT
GCCTGCCAGAGGAGACAAAGCCCAAGAGGGGACGGCGGTCATGGCCTCGAAAAAGAACAGCCACTCACACCTGTGACTA
CGCAGGCTGCGGCAAGACCTACACCAAGAGCTCTCATCTCAAGGCACACCTGAGAACCCACACAGGTGAGAAACCTTAT
CACTGTGACTGGGAAGGCTGCGGATGGAAGTTTGCCCGATCTGATGAACTTACTCGTCATTACCGAAAACACACGGGCC
ACCGCCCTTTCCAGTGCCAGCGGTGTGACAGAGCATTTTCCAGGTCGGATCACCTCGCCTTACACATGAAGAGGCACTT
TTAATTGGAAGCAGTGGATCTTTCCCTAACTGCCTTAGAGATTCAGTATTTACAGCACAAGGACTGCTTTCCGCAAGAA
GGGGAGAACCCAGTTTAAGCACTACAGAGAATCATGGTGAAGTCTTCCAAAAAGAGTGGAAAGAGGGATAATTGCATAT
GGACATTGCAACTTTTTTTTTTTTAACATACGTTTTAAAGAAAACCAAAAACATTGGGGTCAATGACGTGGATCTTCTT
CTATCATCCCATTGTGTAAATCCAACTTGAATTATTTCCGGACTACAAAATGCCAGGAGTGACTGAAGTCACGGATATC
AGGTTAAACCAGACTGCGTAGTTCGGAGGGTCGGGATTCTCACCCGGGGGAAATGACATTCCCTTAATTTTCCTTTCAA
TGCATTATTAGATGTACTTGTCATCTTGTACTCCCTTTTTCTTCCTTCTAAAAGCCTTACATGTTACAGAGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
 
4-6
stage 4
stage 4
stage 5
Hensen's Node
Primitive Streak
 
7-12
stage 8
Neural Plate/Tube
neural folds
19-24
stage 21
stage 21
stage 23
Head Mesenchyme
Spinal Ganglia and Nerves
Tail
 
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Face Mesenchyme
Leg Ectoderm
Leg Mesenchyme
Sclerotome
Spinal Ganglia and Nerves
Surface Ectoderm
Tail
Trunk Mesenchyme
Wing Mesenchyme
Beak
beak
eye muscles (dorsal and ventral oblique, lateral rectus)
inner thigh
trigeminal?

Entry 2

GEISHA IdKLF4.Antin.2010Data SourcePublication
Complete cDNA Template Probeshow
CCCGGCTACCCGACCTTCCTGCCCGAGCAGCTGCCCCCCGGCACGCTGCAGTACCAAGAGCTGATGCCGCCGGGGAGCT
GCCTGCCAGAGGAGACAAAGCCCAAGAGGGGACGGCGGTCATGGCCTCGAAAAAGAACAGCCACTCACACCTGTGACTA
CGCAGGCTGCGGCAAGACCTACACCAAGAGCTCTCATCTCAAGGCACACCTGAGAACCCACACAGGTGAGAAACCTTAT
CACTGTGACTGGGAAGGCTGCGGATGGAAGTTTGCCCGATCTGATGAACTTACTCGTCATTACCGAAAACACACGGGCC
ACCGCCCTTTCCAGTGCCAGCGGTGTGACAGAGCATTTTCCAGGTCGGATCACCTCGCCTTACACATGAAGAGGCACTT
TTAATTGGAAGCAGTGGATCTTTCCCTAACTGCCTTAGAGATTCAGTATTTACAGCACAAGGACTGCTTTCCGCAAGAA
GGGGAGAACCCAGTTTAAGCACTACAGAGAATCATGGTGAAGTCTTCCAAAAAGAGTGGAAAGAGGGATAATTGCATAT
GGACATTGCAACTTTTTTTTTTTTAACATACGTTTTAAAGAAAACCAAAAACATTGGGGTCAATGACGTGGATCTTCTT
CTATCATCCCATTGTGTAAATCCAACTTGAATTATTTCCGGACTACAAAATGCCAGGAGTGACTGAAGTCACGGATATC
AGGTTAAACCAGACTGCGTAGTTCGGAGGGTCGGGATTCTCACCCGGGGGAAATGACATTCCCTTAATTTTCCTTTCAA
TGCATTATTAGATGTACTTGTCATCTTGTACTCCCTTTTTCTTCCTTCTAAAAGCCTTACATGTTACAGAGG
CitationAntin PB, Pier M, Sesepasara T, Yatskievych TA, Darnell DK. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family. Dev Dyn. 2010 Jun;239(6):1879-87.
CopyrightCopyright © 2010 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAuthors indicated probe came from ChEST913e4. The partial NCBI sequence associated with this clone is shown here.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
 
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
Face Mesenchyme
Lateral Plate Mesoderm
Leg Mesenchyme
Limb Buds
Pharyngeal Arches and Clefts
Sclerotome
Surface Ectoderm
Tail
Trunk Mesenchyme
ribs, pelvis, axial skeleton
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.38576

Mouse

EmageMGI:1342287
EurexpressMGI:1342287
MGI GXDMGI:1342287

Frog

Xenbase1015048

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-111014-1, ZDB-GENE-010129-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona