GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KLF6
Kruppel like factor 6

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolKLF6
Official Full NameKruppel like factor 6
CGNC ID5329
also known asKrueppel-like factor 6, KLF6
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001030969
PolypeptideNP_001026140
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.11841
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1316ENSG00000067082MIM:137215MIM:602053
Mouse23849ENSMUSG00000000078All phenotypic alleles (4):Targeted, knock-out(1) Targeted, other(3) MGI:1346318
Xenopus493232, 446965, 379949, 100127627, 443752986302, 1008747
Zebrafish280650, 793760ENSDARG00000029072ZDB-GENE-021115-9, ZDB-GENE-070912-633ZFIN:ZDB-GENE-021115-9, ZFIN:ZDB-GENE-070912-633
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420463
Ensembl Gene
KEGGgga:420463

Entry 1

GEISHA IdChEST837d22Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
TCGTGGGCTAAGAGGCGTCAAGGTTGAAGAGCCTTGAGCAGAGGGATGCGTGTTCCAGCCAAAGCATGCCATTTTGCAC
CCTACCCAGTTGCCTCCAGGACCTCACTTCCTTGAAGGTCTTTTGAGGGCTAATAAGTCATGTAAGAAACGGCATAGCA
ACCATGGTGCGTGATGTTTGGGGTTTCCTGGACTCATACACTGGTATCTAACCTTCTGAGTGGCTCCTAAGCCTTTGCC
GTGAGCATGTGCACTGAGAATGTTAATGATTGGGCGACTGTATGCTATGAGGATCTATTGACGATTGTATGCTGAGGCA
CATTTTTTTTCTTGTGGTTGTTTTATAACTGTAAGAGAAAAAAAAAAAAAAGTCTGAATGTCTTGTATGTGAGGAATAT
CTCGTGAGATGGGACGACCACCAATCATTTCCAAGGGATGGGGGGAGGGCTGTCTGCACCTTTTTAGAGGGAAAACAGA
GAGGGGAAAGGGGAATTAAAAAGAGTCAGGATGCCAGAATGGAGATGGGGACCTCCCCGTTCCTGTGTGAGAGGAGCTT
TAGGTGTCTGGTGCAGCTATTAAACGTGCAATGTGTCAAGTAGCTTGTTTTACTTGCTACAGAGCTCATTTGTAATCCA
TTGTATAAGCTGTGTATTTACAAATGTAACACAACTATAACTTTTCATTATAATACAAAAGTTATTGCATGGTCCTGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Anterior Intestinal Portal
Epiblast
Head Process
Neural Plate/Tube
Primitive Streak
 
7-12
stage 8
stage 9
stage 9
stage 9
stage 9
stage 9
stage 10
stage 10
stage 10
stage 10
stage 10
Blood Islands
Early Endoderm
Endoderm
Epiblast
Extraembryonic
Forebrain
Head Mesenchyme
Liver
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Surface Ectoderm
Spots
endothelia
13-18
stage 14
stage 14
stage 15
stage 17
stage 18
stage 18
stage 18
Hindbrain
Midbrain
Myotome
Pituitary (Rudiment)
Somites
Spinal Cord
Veins
 
19-20
stage 19
stage 19
stage 20
Myotome
Pituitary (Rudiment)
Spinal Cord
crud

Entry 2

GEISHA IdKLF6.Antin.2010Data SourcePublication
Complete cDNA Template Probeshow
TCGTGGGCTAAGAGGCGTCAAGGTTGAAGAGCCTTGAGCAGAGGGATGCGTGTTCCAGCCAAAGCATGCCATTTTGCAC
CCTACCCAGTTGCCTCCAGGACCTCACTTCCTTGAAGGTCTTTTGAGGGCTAATAAGTCATGTAAGAAACGGCATAGCA
ACCATGGTGCGTGATGTTTGGGGTTTCCTGGACTCATACACTGGTATCTAACCTTCTGAGTGGCTCCTAAGCCTTTGCC
GTGAGCATGTGCACTGAGAATGTTAATGATTGGGCGACTGTATGCTATGAGGATCTATTGACGATTGTATGCTGAGGCA
CATTTTTTTTCTTGTGGTTGTTTTATAACTGTAAGAGAAAAAAAAAAAAAAGTCTGAATGTCTGGTATGTGAGGAATAT
CTCGTGAGATGGGGACGACCACCAATCATTTCCAAGGGGATGGGGGGAGGGCTGTCTGCACCTTTTTAGAGGGAAAACA
GAGAGGGGAAGGGGGACTTAAAAAGAGTCAGGATGCCAGAATGGGACGATGGGGACCTCCCCGTTCCTGGTGTGAGAGG
AGCTTAAGGTGTCTGGTGCAGCTATTAAACGTGCAATGGTGTCAAGTAGCTGGTTTAACTTGCTACAGAGCTCATTTGT
AATCCATN
CitationAntin PB, Pier M, Sesepasara T, Yatskievych TA, Darnell DK. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family. Dev Dyn. 2010 Jun;239(6):1879-87.
CopyrightCopyright © 2010 John Wiley & Sons, Inc. All Rights Reserved.
CommentsProbes were prepared using the entire cDNA insert in each EST clone. KLF 6 was made using clone ChEST837d22, which is represented in genbank by BU485220.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Epiblast
 
7-12
stage 7
stage 10
Early Endoderm
Endoderm
Epiblast
Lateral Plate Mesoderm
Surface Ectoderm
 
19-20
stage 20
stage 20
Myotome
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.11841

Mouse

EmageMGI:1346318
EurexpressMGI:1346318
MGI GXDMGI:1346318

Frog

Xenbase986302, 1008747

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-021115-9, ZDB-GENE-070912-633
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona