GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LIN28A
lin-28 homolog A

Gene
Official SymbolLIN28A
Official Full Namelin-28 homolog A
CGNC ID228
also known asLIN28, protein lin-28 homolog A|Lin-28.1|lin-28A
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001031774
PolypeptideNP_001026944
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.21004
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly38639FBgn0035626
Human79727ENSG00000131914MIM:611043
Mouse83557ENSMUSG00000050966All phenotypic alleles (1):Targeted, knock-out(1) MGI:1890546
Xenopus548523, 387262491383
Zebrafish799825, 394066ENSDARG00000004328, ENSDARG00000016999ZDB-GENE-040426-747ZFIN:ZDB-GENE-040426-747
Gene Ontology
Molecular FunctionDNA binding, RNA binding, zinc ion binding
Biological ProcessmiRNA catabolic process, pre-miRNA processing, regulation of transcription, DNA-templated, more...RNA 3'-end processing, stem cell maintenance
Cellular Componentcytoplasmic mRNA processing body, cytoplasmic stress granule, nucleus
Links to other databases
Entrez Gene428206
Ensembl GeneENSGALG00000000388
KEGGgga:428206

Entry 1

GEISHA IdLIN28A.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCTCTGAAACACAGGGCTGGAAG
Reverse cDNA Template PrimerTCACTTGGCATTGGCTTTGGcDNA Template Length275
Complete cDNA Template Probeshow
CTCTGAAACACAGGGCTGGAAGTGCTCTTCTTTACCACACAGAGTAGCACATGGCTCAGTGGAGCTCAGCCTTCTGCGT
GGATCAAACCCACGTGGGACAAACACTGCTGCTCCTCCTGCTCACGCTGCACCAGCACCCTGGGCTAAGCCTCCCATGG
GTACAGGAAAACAGGGACCTGGGGTGGCAGTGGCTGCCCTCATCCCTCCCCAGCCTTGCCTTTATTTATTGGCCCCAGT
GACAGCCCTTCTTCTGAGGCCAGATGCCCCGATTGTGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Area Pellucida
Epiblast
 
4-6
stage 4
stage 5
stage 5
stage 6
Area Pellucida
Epiblast
Headfold
 
7-12
stage 9
stage 10
stage 11
stage 12
Anterior Intestinal Portal
Forebrain
Head Mesenchyme
Hensen's Node
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Spinal Cord
 

Entry 2

GEISHA IdLIN28.Yokoyama.2008Data SourcePublication
Complete cDNA Template Probeshow
AGAGCAAGAGCCTGCAGAAACGCAGATCAAAAGGAGATCGATGCTACAACTGCGGCGGGCTGGACCACCATGCCAAAGA
GTGCAAGCTGCCTCCGCAGCCCAAGAAATGCCACTTCTGCCAGAGCATCAGCCACATGGTCGCCAACTGCCCTGCCAAA
GCTCAGCAGTCCCCCAGCTCTCAGGGAAAGCCTGCCTACTTCCGCGAGAAGGAGGACATGCACAGCTCGGCCCTGCTCC
CCGAAACCCGGGAATGATGGCAGGCGGCAGGGAGGGCTAACACCAGGATGGAGAGGCTTTGGCAAGGCAAACGGGGAGG
GATGAGGGCAGAACCTTATTCTCTTTAAAGCCCGGCTTTAATTGGGATGGCTCCAAAAATAGGAGGGGGAGCATCCAAC
ACACCTCTCCCGGACAAAAAACAAATAAATAAATAAATTGGTTCATCTTTCTCCAGGAAGCTAGGAGGAGGAGCAGGGA
GGCACAGCTC
CitationYokoyama S, Hashimoto M, Shimizu H, Ueno-Kudoh H, Uchibe K, Kimura I, Asahara H. Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken. Gene Expr Patterns. 2008 Feb;8(3):155-60.
Copyrighthttp://www.elsevier.com/copyright
CommentsThe cDNA template used to generate the probe was obtained by PCR as described by the authors
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 15
stage 15
stage 15
stage 15
stage 17
stage 17
stage 17
stage 17
stage 17
Ear/Otic Placode
Limb Buds
Mesencephalon
Pharyngeal Arches and Clefts
Retina
Rhombomeres
Somatic Mesoderm
Ubiquitous
 
19-24
stage 20
stage 20
stage 21
stage 24
Central Nervous System
Ear/Otic Placode
Eye
Head Mesenchyme
Heart
Limb Buds
Midbrain
Pharyngeal Arches and Clefts
Somatic Mesoderm
Unlabeled
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.21004

Mouse

EmageMGI:1890546
EurexpressMGI:1890546
MGI GXDMGI:1890546

Frog

Xenbase491383

Fruit Fly

BDGPFBgn0035626

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-747
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona