GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LIN28B
lin-28 homolog B

Gene
Official SymbolLIN28B
Official Full Namelin-28 homolog B
CGNC ID11482
also known asprotein lin-28 homolog B|Lin-28.2|lin-28B
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001034818
PolypeptideNP_001029990
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.14055
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human389421ENSG00000187772MIM:611044
Mouse380669ENSMUSG00000063804All phenotypic alleles (1):Targeted, other(1) MGI:3584032
Xenopus100216028, 3737961218968
Zebrafish
Gene Ontology
Molecular FunctionDNA binding, RNA binding, zinc ion binding
Biological ProcessmiRNA catabolic process, pre-miRNA processing, regulation of transcription, DNA-templated, more...RNA 3'-end processing
Cellular Componentmitochondrion, nucleus
Links to other databases
Entrez Gene421786
Ensembl Gene
KEGGgga:421786

Entry 1

GEISHA IdLIN28B.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAATGTGAGGATGGGCTTCGG
Reverse cDNA Template PrimerTGACAGTAATGGCACTTCTTTGGCcDNA Template Length353
Complete cDNA Template Probeshow
GGAAGGATTTAGAAGCCTAAAAGAAGGAGAACCAGTGGAATTTACTTACAAGAAATCTTCCAAAGGCCTTGAATCAATA
CGGGTAACAGGCCCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGACGACCCAAAGGGAAGACAGTACAAAAAAGAAAAC
CAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCACCACGCTAAAGAATGTAGTCTACCTCCACA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Area Pellucida
Epiblast
 
4-6
stage 4
stage 4
stage 4
stage 5
stage 6
Area Pellucida
Epiblast
Primitive Streak
Sections pending.
7-12
stage 10
stage 11
stage 12
Forebrain
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Midbrain
Paraxial Mesoderm
 

Entry 2

GEISHA IdLIN28B.Bobbs.2012Data SourcePublication
Complete cDNA Template Probeshow
GGAAGGATTTAGAAGCCTAAAAGAAGGAGAACCAGTGGAATTTACTTACAAGAAATCTTCCAAAGGCCTTGAATCAATA
CGGGTAACAGGCCCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGACGACCCAAAGGGAAGACAGTACAAAAAAGAAAAC
CAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCACCACGCTAAAGAATGTAGTCTACCTCCACA
CitationBobbs AS, Saarela AV, Yatskievych TA, Antin PB. Fibroblast growth factor (FGF) signaling during gastrulation negatively modulates the abundance of microRNAs that regulate proteins required for cell migration and embryo patterning. J Biol Chem. 2012 Nov 9;287(46):38505-14.
Copyright© 2012 by The American Society for Biochemistry and Molecular Biology, Inc.
CommentsThe cDNA template for the probe was obtained from the author.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Epiblast
control embryo
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.14055

Mouse

EmageMGI:3584032
EurexpressMGI:3584032
MGI GXDMGI:3584032

Frog

Xenbase1218968

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona