GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LINGO1
leucine rich repeat and Ig domain containing 1

Gene
Official SymbolLINGO1
Official Full Nameleucine rich repeat and Ig domain containing 1
CGNC ID1953
also known asLINGO-1, LRRN6A, leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1|cLINGO-1|leucine rich repeat neuronal 6A, leucine rich repeat neuronal 6A, LINGO-1, LRRN6A
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001024577
PolypeptideNP_001019748
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.13113
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human84894ENSG00000169783MIM:609791
Mouse235402ENSMUSG00000049556All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:1915522
Xenopus100101739921956
Zebrafish564943, 447837ENSDARG00000035899ZDB-GENE-080327-16, ZDB-GENE-040912-136ZFIN:ZDB-GENE-080327-16, ZFIN:ZDB-GENE-040912-136
Gene Ontology
Molecular Functionepidermal growth factor receptor binding
Biological Processcentral nervous system neuron development, negative regulation of oligodendrocyte differentiation, more...neuron projection development, protein kinase B signaling
Cellular Componentintegral component of membrane, plasma membrane
Links to other databases
Entrez Gene415344
Ensembl Gene
KEGGgga:415344

Entry 1

GEISHA IdLINGO-1.Okafuji.2005Data SourcePublication
Complete cDNA Template Probeshow
CTGCAGGAGATCCAGCTGGTGGGAGGGCAGCTCACCACGGTCGAGCCCTTTGCCTTCCGTGGCCTCAATTACCTGCGCA
TCCTGAACGTGTCAGGAAACTTGCTGACCACTCTGGAAGAGTCGGCCTTCCACTCGGTGGGCAACCTGGAGACGCTCAT
CCTCGACAACAACCCCTTGGCCTGCGACTGTCGGCTGCTGTGGGTGTTCCGACGGCGATGGAGGTTGAACTTCAATAAG
CAGCAGCCCACCTGCTCTACCCCCGAGTTCGTCCAGGGCAAGGAGTTCAAAGACTTCCCTGACGTCCTCCTGCCCAACT
ACTTCACCTGCCGCCGAGCTCGGATACGGGACCGCAAACCTCAGCAGATCTTTGTGGACGAAGGCCACACGGTGCATTT
TGTCTGTCGGGCAGACGGGGATCCGCCACCCGCCATCATGTGGCTCTCTCCCCGGAAGCACCTCATCTCCACCAAAACC
AACGGGCGGCTCACTGTCTTCCCTGACGGCACGCTGGAGGTGCGCTACGCCCAGATCCAGGACAACGGCACCTACCTAT
GCATTGCCAGCAACGCGGGTGGCAACGACACCATGCTGGCCCACCTGCACGTGCGCAGCTACTCCCCAGACTGGCCCCA
CCAGCCCAACAAGACCTTCGCGTTCATCTCCAACCAGCCCAACGAGAGCGATGCCAACAGCACACGTGCCACCGTGCCT
TTTCCCTTTGACATCAAGACTCTCATCATCGCCACCACCATGGGCTTCATTTCTTTCCTGGGCGTCGTGCTCTTCTGTC
TGGTGCTCCTCTTCCTGTGGAGCCGGGGGAAAGGCAACACCAAGCACAACATTGAAATCGAGTACGTGCCACGCAAGTC
CGACGCGGGCATCAGCTCTGCCGACGCACCGCGCAAATTCAATATGAAGATGATTTAACCAGGCAACAATTTG
CitationOkafuji T, Tanaka H. Expression pattern of LINGO-1 in the developing nervous system of the chick embryo. Gene Expr Patterns. 2005 Dec;6(1):57-62. Epub 2005 Jul 18.
CopyrightReprinted with permission from Elsevier. Copyright © 2005 Elsevier B.V. All rights reserved.
CommentsThe template for the cLINGO-1 probe was a 942-bp fragment coding 3′ of ORF (1287-2228). The sequence for this was extracted from Acc# NM_001024577.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
stage 9
stage 12
stage 12
Eye
Forebrain
Hindbrain
Midbrain
Telencephalon
 
13-18
stage 17
stage 17
Cranial Nerve
Hindbrain
Midbrain
Retina
Telencephalon
facial nerve
trigeminal nerve
19-24
stage 19
stage 19
stage 23
Forebrain
Hindbrain
Midbrain
Spinal Cord
Spinal Ganglia and Nerves
cerebellum
25-28
stage 25
stage 27
stage 28
Spinal Cord
Spinal Ganglia and Nerves
 

Entry 2

GEISHA IdLINGO1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
CTCATTACCTGCGCATCCTGAACGTGTCAGGAAACTTGCTGACCACTCTGGAAGAGTCGGCCTTCCACTCGGTGGGCAA
CCTGGAGACGCTCATCCTCGACAACAACCCCTTGGCCTGCGACTGTCGGCTGCTGTGGGTGTTCCGACGGCGATGGAGG
TTGAACTTCAATAAGCAGCAGCCCACCTGCTCTACCCCCGAGTTCGTCCAGGGCAAGGAGTTCAAAGACTTCCCTGACG
TCCTCCTGCCCAACTACTTCACCTGCCGCCGAGCTCGGATACGGGACCGCAAACCTCAGCAGATCTTTGTGGACGAAGG
CCACACGGTGCATTTTGTCTGTCGGGCAGACGGGGATCCGCCACCCGCCATCATGTGGCTCTCTCCCCGGAAGCACCTC
ATCTCCACCAAAACCAACGGGCGGCTCACTGTCTTCCCTGACGGCACGCTGGAGGTGCGCTACGCCCAGATCCAGGACA
ACGGCACCTACCTATGCATTGCCAGCAACGCGGGTGGCAACGACACCATGCTGGCCCACCTGCACGTGCGCAGCTACTC
CCCAGACTGGCCCCACCAGCCCAACAAGACCTTCGCGTTCATCTCCAACCAGCCCAACGAGAGCGATGCCAACAGCACA
CGTGCCACCGTGCCTTTTCCCTTTGACATCAAGACTCTCATCATCGCCACCACCATGGGCTTCATTTCTTTCCTGGGCG
TCGTGCTCTTCTGTCTGGTGCTCCTCTTCCTGTGGAGCCGGGGGAAAGGCAACACCAAGCACAACATTGAAATCGAGTA
CGTGCCACGCAAGTCCGACGCGGGCATCAGCTCTGCCGACGCACCGCGCAAATTCAATATGAAGATGATTTAACCAGGC
AACAATTTGCAAATAGTTTTGGGGTTTTGTTTTTTGNTTTTTNTTNTTTAAACAAANGAGAACCTAATGAACAAATAAA
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST905c4. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Dermomyotome
Ear/Otic Placode
Eye
Forebrain
Foregut
Gut
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Somatic Mesoderm
Splanchnic Mesoderm
section 32
section 43

Entry 3

GEISHA IdLINGO1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CTCAATTACCTGCGCATCCTGAACGTGTCAGGAAACTTGCTGACCACTCTGGAAGAGTCGGCCTTCCACTCGGTGGGCA
ACCTGGAGACGCTCATCCTCGACAACAACCCCTTGGCCTGCGACTGTCGGCTGCTGTGGGTGTTCCGACGGCGATGGAG
GTTGAACTTCAATAAGCAGCAGCCCACCTGCTCTACCCCCGAGTTCGTCCAGGCAAGGAGTTCAAAGACTTCCCTGACG
TCCTCCTGCCCAACTACTTCACCTGCCGCCGAGCTCGGATACGGGACCGCAAACCTCAGCAGATCTTTGTGGACGAAGG
CCACACGGTGCATTTTGTCTGTCGGGCAGACGGGGATCCGCCACCCGCCATCATGTGGCTCTCTCCCCGGAAGCACCTC
ATCTCCACCAAAACCAACGGGCGGCTCACTGTCTTCCCTGACGGCACGCTGGAGGTGCGCTACGCCCAGATCCAGGACA
ACGGCACCTACCTATGCATTGCCAGCAACGCGGGTGGCAACGACACCATGCTGGCCCACCTGCACGTGCGCAGCTACTC
CCCAGACTGGCCCCACCAGCCCAACAAGACCTTCGCGTTCATCTCCAACCAGCCCAACGAGAGCGATGCCAACAGCACA
CGTGCCACCGTGCCTTTTCCCTTTGACATCAAGACTCTCATCATCGCCACCACCATGGGCTTCATTTCTTTCCTGGGCG
TCGTGCTCTTCTGTCTGGTGCTCCTCTTCCTGTGGAGCCGGGGGAAAGGCACACCAAGCACAACCATTGAAATCGAGTA
CGTGCCACGCAAGTCC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.13113

Mouse

EmageMGI:1915522
EurexpressMGI:1915522
MGI GXDMGI:1915522

Frog

Xenbase921956

Fruit Fly

BDGP

Zebra Finch

ZEBrALINGO1

Zebrafish

ZFINZDB-GENE-080327-16, ZDB-GENE-040912-136
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona