GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LIX1
limb and CNS expressed 1

Gene
Official SymbolLIX1
Official Full Namelimb and CNS expressed 1
CGNC ID49108
also known asprotein limb expression 1|Lix1 homolog|limb expression 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204347
PolypeptideNP_989678
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.93
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human167410ENSG00000145721MIM:610466
Mouse66643ENSMUSG00000047786All phenotypic alleles (1):Targeted, knock-out(1) MGI:1913893
Xenopus100497418976692
Zebrafish558010ENSDARG00000052154ZDB-GENE-060526-123ZFIN:ZDB-GENE-060526-123
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene374264
Ensembl Gene
KEGGgga:374264

Entry 1

GEISHA IdLIX1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
ATGGACAGAACCTTGGAATCTTTGCAGCTGGTGATTGCCCGAGTTCTGCCTCACAGAGACCCTGCCCTGGTGTTTAAGG
ACTTGAATGTTGTAGCAATATTGCAAGAGTTCTGGGAAAGCAAACAGAAGAAGAAGGCCGTACTTCCAAGTGAAGGCAT
CATTGTGTATGAGTCACTGAGCAGCCTGGGCCCACCATTTGTGAGTTATGTTACCTTGCCTGGAGGAAGTTGTTTCGGT
AACTTTCAGAGCTGTTTAAGCAGAGCAGAGGCAAGGCGGGATGCTGCAAAAGTGGCTCTGATCAACTCTCTCTTTAATG
AATTGCCCTGTCGCAGAATCACAAAGGAATTCATCATGGAAAGTGTTCAGGAGGCTGTTTCCTCAACAAGTGGCAACCT
AAAGGATGCTGATGACCCCAGCACTAGTATTGGAGCTTATCATTATATGCTAGAATCAAACATTGGAAAGACAATGCTG
GAATTTCAGGAGCTGATGATTGTCTTTCAGCTTCTGCATTGGAATGGAAGCCTTAAAGCTCTACGGGAAACAAAGTGCT
CCCGGCAGGAAGTAATTTCCTACTACTCCCAGTGTTCCTTAGATGAAAAGATGAGAAGTCACATGGCCCTGGACTGGAT
TATGAAGGAGCAAGAATCTCCAGGAATTATTTCCCAAGAGCTGCAAGTGGCACTGAGGGAACTGGAAGAAGTCAGGAAA
GCTGGGCATGAACTGAGGTTCTACAAAGAGAAGAAGGAAATACTGAGCTTAGCACTGAGTCAGATCTACAGTGATGAAG
TTACCACTTCCTCATGGGACAATCAAATGAGCTTGGCCCTACATGGCTANCGCTAA
CommentsImages and probe sequence provided by Claire Anderson. The probe was supplied by Sandrine Faure. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Somites
Splanchnic Mesoderm
HH12+

Entry 2

GEISHA IdLIX1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GTTCCGAAGAAGGAAGCCGCGCACCGAGCGTGCCAGCCTGCTTTGCTGTTCCTTAGCGCAGCGCAGGGGGAGGTGGGCC
CTTGGAGTGCCTTGGAGTTTGAGGCAGTGCCTGATTGGGAGACGAGGGGATATTCCTCAGGAGCCCGGTGCATCAATGA
ACTGCTGCAGGAAGGCAGTGCGGGGCTCGGCTCGCTCGGGCATGAGGACAGCTGGTGGCCGCTGTCTGGTAAAGCAGGA
CGGAGATGGACAGAACCCTGGAGTCTTTGCAGCTGGTGATTGCCCGAGTTCTGCCTCACAGAGACCCTGCCCTGGTGTT
TAAGGACTTGAATGTTGTAGCAATATTGCAAGAGTTCTGGGAAAGCAAACAGAAGAAGAAGGCCGTACTTCCAAGTGAA
GGCATCATTGTGTATGAGTCACTGAGCAGCCTGGGCCCACCATTTGTGAGTTATGTTACCTTGCCTGGAGGAAGTTGTT
TCGGTAACTTTCAGAGCTGTTTAAGCAGAGCAGAGGCAAGGCGGGATGCTGCAAAAGTGGCTCTGATCAACTCTCTCTT
TAATGAATTGCCCTGTCGCAGAATCACAAAGGAATTCATCATGGAAAGTGTTCAGGAGGCTGTTTCCTCAACAAGTGGC
AACCTAAAGGATGCTGATGACCCCAGCACTAGTATTGGAGCTTATCATTATATGCTAGAATCAAACATTGGAAAGACAA
TGCTGGAATTTCAGGAGCTGATGATTGTCTTTCAGCTTCTGCATTGGAATGGAAGCCTTAAAGCTCTACGGGAAACAAA
GTGCTCCCGGCAGGAAGTAATTTCCTACTACTCCCAGTGTTCCTTAGATGAAAAGATGAGAAGTCACATGGCCCTGGAC
TGGATTATGAAGGAGCAAGAATCTCCAGGAATTATTTCCCAAGAGCTGCAAGTGGCACTGAGGGAACTGGAAGAAGTCA
GGAAAGCTGGGCATGAACTGAGGTTCTACAAAGAGAAGAAGGAAATACTGAGCTTAGCACTGAGTCAGATCTACAGTGA
TGAAGTTACCACTTCCTCATGGGACAATCAAATGAGCTTGGCCCTACATGGCTACCGCTAACTTTGAAGAAGGCGTTTT
AACATGCCAGTGTAGGTTAAAAATAGTCTCCATGTAAGTTGTTAGTATTCTTTTCCATAGATGTTTTAATTTCTGTATC
TAAAAGCACAGATGTCTTTCTTTTTTAAAAAATAATTTTTATTTCAGTGGCTAGAAATACTCTTCAGGTCAAGCTGCAG
CTGTCATGAAACATTTGATGTAGCGCTGGTACTAAAGTATGTGTAAACCTAAATGGAGACAAAGCAGAGAAAGCTTTTA
TGGTACTCTGAAGGTTGAACTTGATGTGGTACTTGATTTCCACATGAAAACTACACCTTTGCTGAAGACATAAAAATTG
TTGTCACAAACCTACAGAGTGCAAGCAGTAAAAGACAAAAAGGGTAGTTCTAAGCTGCACTGGTGCCTGCTTACTCCCA
GACTTCTTGACAGCATATGTTTCCTCCGATCAGGTGCTATTGCTGAAGTTCGTTGTATTTTTTTGAAGGATATAAGGAA
CCTTTCAAGCAAAAAAAACCTGCAGCATTAAACTAGTACTCCAGATTCAAGGTGCTTTACCCCTGTTGCAGCCAAGATT
TCACAAACCTATGCAAAGATAAAGATGAGCAGAAGTTACTCACTGGCCATGCTCTGTCCAGTATGGCTAACAGATTCTG
TGTGATAAAAATCTTCTAGTTAGACTTTATGTACCTTTTCAAAGAGGATTTACTTGCTTGCACTTCAGCAAATGCCTGC
TGAGGTTCAAGATCTTTCCCTTCCCCATGCTGACTGTCAGCACAATTCCACTACTAGAAGCTGCTGTCCCTAGGGCAAA
GTCAGCAGCATAAGCCTGCATGAGGCACACACTCATAATAACCAGCATGCCATTTTAGCTGATGATGACAGCAGGAAGG
TGCTAAGATGCTGGTCAATGAACTTAAATGCACTTCTCCGTAGTTCTGTTTCCTGCTAGTTTCTGCCAGAAGAATGAAC
ACCTAGCATAGCCACAGTTTAAATCAACTCAGTAACCTCAGTAGTATCTCTTAGCATCAGTACAATTTGCTTTAAACAT
AAAAGAGCAAATTCTACGTAAAAGAGACAAACAGTTCAGTTGGAGGAAAAGCAGGCTGGGGAGAATTTATTTTCATCCC
TTGCACAAGTGGATACCCAACAATGTCACATCTCATATAAAAAAGACAGGAGAATAGGTCAGCAGTAATAATTGTGTTG
CAAAACCACACACACCACTGCTAGAGGGAGTTCCCTGGAGTGCCTTACGAGAGAAAACTCTCATTTTTTATCTCCTTTC
AGTCGTTCATTTAAAAAATGTACGAAGCTGTATGGCTCTGTTACTCAAAAATTTGTTTTCTTAACTGAAAGAGAAAAAT
TTTCCTAGCTTTTAATGTTTAGTTTTCTTTCAGGGCGTTTCAAATGTATAACAATAAAGTGAAAGTAATTTTCACACTG
CATCAATAGATTGTACATACTCCCGTGTGCATTTAGGTTGTGTAATTTAGGCAGTGGTTTGCTTCCCATCAATGTAGTA
TGTAAACTGTTTAAAACAGTAGGTTATAGAAAAAGTACTGGAAAAACTTGGATTGCTTTGATTTTTGTTTGGTGATCCG
ATGAAGAAATAAACAATCACACTCCCGTGGACTGA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204347.2 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.93

Mouse

EmageMGI:1913893
EurexpressMGI:1913893
MGI GXDMGI:1913893

Frog

Xenbase976692

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-060526-123
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona