GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LMX1B
LIM homeobox transcription factor 1 beta

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolLMX1B
Official Full NameLIM homeobox transcription factor 1 beta
CGNC ID621
also known asLMX, LMX1, LIM/homeobox protein LMX-1.2|LIM homeobox protein|LIM/homeobox protein 1|homeobox protein LMX-1|homeodomain protein (lmx), LIM/homeobox protein LMX-1.2, LIM-homeobox protein 1, LMX, Homeobox protein LMX-1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205358
PolypeptideNP_990689
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.758
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly39406FBgn0052105
Human4010ENSG00000136944MIM:161200MIM:602575
Mouse16917ENSMUSG00000038765All phenotypic alleles (12):Targeted, knock-out(1) Targeted, other(11) MGI:1100513
Xenopus100497942920040
Zebrafish554360, 554361ENSDARG00000068365ZDB-GENE-050114-2, ZDB-GENE-050114-3ZFIN:ZDB-GENE-050114-2, ZFIN:ZDB-GENE-050114-3
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity, more...zinc ion binding
Biological Processmulticellular organismal development, transcription, DNA-templated
Cellular Componentnucleus
Links to other databases
Entrez Gene396312
Ensembl GeneENSGALG00000000936
KEGGgga:396312

Entry 1

GEISHA IdChEST264j14Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CAACAGGAGACCTAAACGACCAAGGACAATACTTACTACACAGCAGAGACGAGCATTCAAAGCATCCTTTGAAGTGTCT
TCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTGTCCAGGTTGGTTTCAA
AACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAATTCTCAGCGACTAGGGC
AAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCGCAGCAGCAGATTGTAGC
AATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGCCAGGCGACCACATGAAC
CCTTATGGTAAGGCATGCATCATTCTGCCGCATCAGAAATAGCAGGGTTCGTATGCTGGTTCACACTCCAAAGGTTCAA
CGGAGTTTCTTGCTGTTATAATATTTTTCTGGGATTTGTACAAAGGAATTTCTACTGGTCAGTTTTGCGTGTATATTTT
CGTGTACACATAAAAGGGTAGAAGAGGGCTCTTCCCAGCCTCTGGACACTACTACAGAGTATAGTTTGATAAATGATAA
AGAAAAGCAACATTATCTCTCCAGCTCCACTTTTTTAAATCACTGTCCAAGACTAAAAATAAACAGTGACAAATTTTCT
TTACCCCCAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Neural Plate/Tube
Unlabeled
 
7-12
stage 8
stage 9
stage 10
stage 11
stage 12
Forebrain
Head Mesenchyme
Hindbrain
Isthmus/MHB
Midbrain
Neural Plate/Tube
 
13-18
stage 13
stage 15
stage 16
stage 18
Ear/Otic Placcode
Forebrain
Head Mesenchyme
Head Process
Hindbrain
Isthmus/MHB
Leg
Limb Buds
Midbrain
Spinal Cord
Wing
FP or HP?
19-21
stage 20
stage 21
Ear/Otic Placcode
Forebrain
Head Mesenchyme
Head Process
Leg Mesenchyme
Nephric Tubules
Wing Mesenchyme
 

Entry 2

GEISHA IdLmx1.Prin.2004Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationPrin F, Logan C, D'Souza D, Ensini M, Dhouailly D. Dorsal versus ventral scales and the dorsoventral patterning of chick foot epidermis. Dev Dyn. 2004 Mar;229(3):564-78.
CopyrightWiley-Liss, Inc. 2004
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 27
stage 30
stage 30
Limb Buds
 
31-36
stage 36
Limb Buds
 

Entry 3

GEISHA IdLmx1.Zuzarte-Luis.2007Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationZuzarte-Luis V, Montero JA, Kawakami Y, Izpisua-Belmonte JC, Hurle JM. Lysosomal cathepsins in embryonic programmed cell death. Dev Biol. 2007 Jan 1;301(1):205-17. Epub 2006 Aug 12.
Copyright2006 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205358).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-35
stage 35
Limb Buds
stage not given

Entry 4

GEISHA IdLMX1.Holmes.2003Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationHolmes G, Crooijmans R, Groenen M, Niswander L (2003). ALC (adjacent to LMX1 in chick) is a novel dorsal limb mesenchyme marker. Gene Expr Patterns. 2003 Dec;3(6):735-41.
CopyrightCopyright © 2003 Elsevier B.V. All rights reserved.
CommentsThe authors said: The chick LMX1 plasmid was from Juan Carlos Izpisua-Belmonte. As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205358).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 17
Limb Buds
 
19-24
stage 22
Limb Buds
 
31-44
stage 44
Limb Buds
All images in Fig. 3.

Entry 5

GEISHA IdLMX1B.Agarwala.2005Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationAgarwala S, Aglyamova GV, Marma AK, Fallon JF, Ragsdale CW. Differential susceptibility of midbrain and spinal cord patterning to floor plate defects in the talpid2 mutant. Dev Biol. 2005 Dec 1;288(1):206-20. Epub 2005 Oct 21.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205358).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-26
stage 26
Isthmus/MHB
Midbrain
Medial Floor Plate

Entry 6

GEISHA IdLMX1.Tomas.2011Data SourcePublication
Complete cDNA Template Probeshow
TTCCTGGAGAGGTGCTTCCCGCGCGGCCGACGGACTGCGCCAAGATGCTGGACGGCATCAAGATGGAAGATCACCCGCT
GCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCCGCACCAGGCCGTGTGCGAAGGCTGCCAGAGG
CCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCACGAGGAGTGTTTGCAGTGCGCGGTGTGTCAGC
AAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCAAACAGGACTACCAACAGCTTTTTGCTGCCAA
GTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAGAGCCCTGGAGTGTGTTTACCACTTAAGCTGC
TTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTTGTTCTTAAGGAAGGGCAGTTGCTCTGTAAAA
GTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACGATTCCGACTCAGTTAAAAGCGATGATGAAGA
TGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAGTGATGATGGGAAGGACCCAAGGAGACCTAAA
CGACCAAGGACAATACTCACTACGCAAGCAGAGACGAGCATTCAAAGCATCCTTTGAAGTTGTCTTCCAAGCCCCTGTA
GGAAGGTCAGAGAAACTTCTAGCAGCTGCCTCTGGGACTTGCAAAGAGCATATTTAGGGAAGACTTTATTTGGTGGTGC
TTT
CitationTomás AR, Certal AC, Rodríguez-León J. FLRT3 as a key player on chick limb development. Dev Biol. 2011 Jul 15;355(2):324-33.
CommentsProbe for lmx-1 was obtained from chicken EST ChEST100c17.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-14
stage 14
stage 14
stage 14
stage 14
Wing AER
Wing Mesenchyme
control embryo

Entry 7

GEISHA IdLMX1B.Abello.2010Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationAbelló G, Khatri S, Radosevic M, Scotting PJ, Giráldez F, Alsina B., Independent regulation of Sox3 and Lmx1b by FGF and BMP signaling influences the neurogenic and non-neurogenic domains in the chick otic placode. Dev Biol. 2010 Mar 1;339(1):166-78. Epub 2010 Jan 4.
CopyrightCopyright © 2009 Elsevier Inc. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205358.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 9
stage 9
stage 10
stage 10
stage 10
stage 10
Ear/Otic Placode
Midbrain
Neural Plate/Tube
Placode
Rhombomeres
HH stage9+

Entry 8

GEISHA IdLMX1B.Adams.2000Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationAdams KA, Maida JM, Golden JA, Riddle RD. The transcription factor Lmx1b maintains Wnt1 expression within the isthmic organizer. Development. 2000 May;127(9):1857-67.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors.
CommentsAs insufficient information is provided in the publication to verify the exact sequence used to synthesize the probe, the sequence below was obtained from NCBI (acc # NM_205358.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
Neural Plate/Tube
 
7-12
stage 9
stage 9
stage 10
stage 10
stage 10
stage 12
stage 12
Ear/Otic Placode
Isthmus/MHB
Mesencephalon
Metencephalon
Neural Plate/Tube
 
13-18
stage 15
stage 15
stage 15
stage 15
stage 15
stage 15
Ear/Otic Placode
Isthmus/MHB
Mesencephalon
Metencephalon
Neural Plate/Tube
 
19-20
stage 20
stage 20
Diencephalon
Face Mesenchyme
Mesencephalon
Telencephalon
 

Entry 9

GEISHA IdLMX1.Fisher.2008Data SourcePublication
Complete cDNA Template Probeshow
ATGCTGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGT
GCCCGCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTG
GCACGAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTAC
TGCAAACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGA
TGAGAGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGA
GTTTGTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCA
GACGATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAG
GAAGTGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAA
AGCATCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGA
GTTGTCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGCCACCAGCAGCAGCAGGAGCAAC
AAAATTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACC
ACCGCAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAA
ATGCCAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCT
TGAGCGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGCCTGTACTC
TATGCAGAGCTCCTATTTCGCCTCATGA
CitationFisher ME, Clelland AK, Bain A, Baldock RA, Murphy P, Downie H, Tickle C, Davidson DR, Buckland RA. Integrating technologies for comparing 3D gene expression domains in the developing chick limb. Dev Biol. 2008 May 1;317(1):13-23. Epub 2008 Feb 7.
CopyrightCopyright © 2008 Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #U41823.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
stage 22
stage 22
stage 22
stage 22
Eye
Limb Buds
Neural Plate/Tube
 

Entry 10

GEISHA IdLMX1.Altabef.2002Data SourcePublication
Complete cDNA Template Probeshow
ATGCTGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGT
GCCCGCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTG
GCACGAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTAC
TGCAAACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGA
TGAGAGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGA
GTTTGTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCA
GACGATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAG
GAAGTGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAA
AGCATCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGA
GTTGTCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGCCACCAGCAGCAGCAGGAGCAAC
AAAATTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACC
ACCGCAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAA
ATGCCAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCT
TGAGCGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGCCTGTACTC
TATGCAGAGCTCCTATTTCGCCTCATGA
CitationAltabef M, Tickle C. Initiation of dorso-ventral axis during chick limb development. Mech Dev. 2002 Aug;116(1-2):19-27.
CopyrightCopyright © 2012 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #U41823.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
stage 17
Leg
Wing
 

Entry 11

GEISHA IdLMX1B.Havis.2012Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationHavis E, Coumailleau P, Bonnet A, Bismuth K, Bonnin MA, Johnson R, Fan CM, Relaix F, Shi DL, Duprez D. Sim2 prevents entry into the myogenic program by repressing MyoD transcription during limb embryonic myogenesis. Development. 2012 Jun;139(11):1910-20.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_205358.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-29
stage 29
stage 29
Limb Buds
 

Entry 12

GEISHA IdLMX1.Yuan.1999Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationYuan S, Schoenwolf GC. The spatial and temporal pattern of C-Lmx1 expression in the neuroectoderm during chick neurulation. Mech Dev. 1999 Nov;88(2):243-7
Copyright1999 Elsevier Science Ireland Ltd. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_205358.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
stage 5
stage 5
stage 6
stage 6
stage 6
stage 6
Ectoderm
Epiblast
Head Process
Mesoderm
Neural Plate/Tube
Notochord
Primitive Streak
As the notochord forms, transcripts mark the prechordal plate, the elongating notochord and the lateral neuroectoderm (Fig. 3, Fig. 4).
C-Lmx1 was strongly expressed in a butterfly-like pattern in the lateral neuroectoderm.
HH stage 4+
X-section of Fig 4A showing stain in the prechordal plate.
X-section of Fig 4A showing stain in the neuroectoderm and notochord.
X-section of Fig 4A showing stain in the neuroectoderm and prechordal plate.
X-section of Fig. 3A showing stain in the neuroectoderm(ne) and notochord(nc).
X-section of Fig. 3A showing stain in the prechordal plate.
7-12
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 9
stage 9
stage 11
stage 11
stage 11
stage 11
stage 11
stage 11
stage 11
Ectoderm
Foregut
Head Mesenchyme
Head Process
Midbrain
Neural Plate/Tube
Notochord
Primitive Streak
Rhombomeres
C-Lmx1 was strongly expressed in a butterfly-like pattern in the lateral neuroectoderm.
HH ST 8+
HH ST 8-
X-section of Fig 4A showing stain in the foregut(fg).
X-section of Fig 4A showing stain in the neural fold(nf), epidermal ectoderm(ee), and floor plate(fp).
X-section of Fig 4A showing stain in the neural fold(nf), floor plate(fp), and notochord(nc).
X-section of Fig 4A showing stain in the neural fold, neuroectoderm(ne), prechordal plate(pp), and foregut(fg).
X-section of Fig 4A showing stain in the neural fold(nf) and midline foregut(mfg).
X-section of Fig 4A showing stain in the neural fold(nf), neuroectoderm(ne), and midline foregut(mfg).
X-section of fig. 9A showing stain in the dorsal neural tube(dn) and head mesenchyme(hm).
X-section of fig. 9A showing stain in the dorsal neural tube(dn), midbrain(mb) and notochord(nc).
X-section of fig. 9A showing stain in the dorsal neural tube.
X-section of fig. 9A showing stain in the dorsal neutral tube(dn) and floor plate(fp).
dorsal neural tube(dn), head mesenchyme(hm) and midbrain.
13-18
stage 13
stage 13
stage 13
stage 13
stage 16
Ear/Otic Placode
Endoderm
Forebrain
Foregut
Limb Buds
Midbrain
Neural Plate/Tube
X-section shows stain in the dorsal neural tube(dn), floor plate(fp), and the foregut(fg).
X-section shows stain in the dorsal neural tube(dn), floor plate(fp), and the midline endoderm(me).
X-section shows stain in the dorsal neural tube(dn), floor plate(fp), and the otic placode(op).
dorsal neural tube(dn) and hindlimb(hl)
19-22
stage 22
Limb Buds
Neural Plate/Tube
dorsal nueral tube (dn) and hindlimb(hl)

Entry 13

GEISHA IdLmx-1.Stark.2000Data SourcePublication
Complete cDNA Template Probeshow
CCCCATATGGACATCGCCTCGGGCCCCGAGTCCTTGGAGAGGTGCTTCCCGCGCGGCCCGACGGACTGCGCCAAGATGC
TGGACGGCATCAAGATGGAAGATCACCCGCTGCGCTCGGGTCCGGCCACGCTCGGAGTGTTACTGGGGTCGGAGTGCCC
GCACCAGGCCGTGTGCGAAGGCTGCCAGAGGCCCATCTCGGATCGCTTTCTGATGAGGGTGAACGAGTCCTCCTGGCAC
GAGGAGTGTTTGCAGTGCGCGGTGTGTCAGCAAGCCCTCACCACCAGCTGCTACTTCCGGGACCGAAAGCTCTACTGCA
AACAGGACTACCAACAGCTTTTTGCTGCCAAGTGCAGTGGCTGCATGGAAAAAATTGCCCCAACAGAATTTGTGATGAG
AGCCCTGGAGTGTGTTTACCACTTAAGCTGCTTCTGTTGCTGTGTTTGTGAGCGACAGCTGAGAAAAGGGGATGAGTTT
GTTCTTAAGGAAGGGCAGTTGCTCTGTAAAAGTGACTATGAGAAAGAGAAGGACCTGTTGAGCTCCGTCAGCCCAGACG
ATTCCGACTCAGTTAAAAGCGATGATGAAGATGGAGATGTTAAGCCCACCAAAGGACAAGTAACACAAGGAAAAGGAAG
TGATGATGGGAAGGACCCAAGGAGACCTAAACGACCAAGGACAATACTCACTACGCAGCAGAGACGAGCATTCAAAGCA
TCCTTTGAAGTGTCTTCCAAGCCCTGTAGGAAGGTCAGAGAAACTCTAGCAGCTGAAACAGGACTCAGTGTGCGAGTTG
TCCAGGTTTGGTTTCAAAACCAAAGAGCAAAGATGAAAAAACTAGCACGAAGGCACCAGCAGCAGCAGGAGCAACAAAA
TTCTCAGCGACTAGGGCAAGAAGTAATGTCTAACCGAATGGAAGGAATGATGACATCTTACACACCACTTGCACCACCG
CAGCAGCAGATTGTAGCAATGGATCAAAGCAGTTATGGCACAGACCCATTTCAGCAGGGTCTGACCCCTCCACAAATGC
CAGGCGACCACATGAACCCTTATGGAAACGACTCCATTTTTCATGATATCGACAGTGATACCTCTTTAACTAGCTTGAG
CGACTGTTTTCTTGCCTCTTCTGAAGTTAACTCCATGCAGGCTAGGGTAGGAAACCCCATTGACAGGCTGTACTCTATG
CAGAGCTCCTATTTCGCCTCATGAAAATAAACGAAAACAAACAGCCGGCGTGTATTTAGCCAGTGACTTTTTCCGTGCA
GCCTCTACAGCCATATGTTGCGCAGCTCTTCCTTCACAGTGACTCCTGCTGCCTCTGGACTGCAAAGAGCATTTTTAGG
AAGACTTTATTTGTGTGCATATATGTATGTATGTACGTGCATATATCAGTACCTACCTACCTACATACATACATATATA
AACAAAACACATCCACCAGTCACATACCCTTGATT
CitationStark MR, Rao MS, Schoenwolf GC, Yang G, Smith D, Mauch TJ. Frizzled-4 expression during chick kidney development. Mech Dev. 2000 Nov;98(1-2):121-5.
CopyrightCopyright © 2000 Elsevier Science Ireland Ltd.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_205358).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
Limb Buds
Mesonephros
 
19-24
stage 24
stage 24
Limb Buds
Renal
 
31-44
stage 40
stage 40
stage 44
stage 44
Renal
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.758

Mouse

EmageMGI:1100513
EurexpressMGI:1100513
MGI GXDMGI:1100513

Frog

Xenbase920040

Fruit Fly

BDGPFBgn0052105

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050114-2, ZDB-GENE-050114-3
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona