GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LOX
lysyl oxidase

Gene
Official SymbolLOX
Official Full Namelysyl oxidase
CGNC ID49824
also known asprotein-lysine 6-oxidase
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205481
PolypeptideNP_990812
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.48063
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Functioncopper ion binding, protein-lysine 6-oxidase activity
Biological Process
Cellular Componentextracellular space
Links to other databases
Entrez Gene396474
Ensembl Gene
KEGGgga:396474

Entry 1

GEISHA IdLOX.Anderson.2022Data SourceDirect Submission
Complete cDNA Template Probeshow
CGGCAGCCGCGCCGCCGCCAGCCCCTCGTCGGCGGCCCCGCGGTCCGGAGGTCCCGGCGACGAGAGCGAGCGGAGCGCC
GGAGGGCTGCCCGCGCCCAGCGGTCTGCGGCCCGGGCGGGAGGACGTGATGGTGGGCGACGACCCCTACAGCCCCTACA
AGTACACGGACGATAACCCCTACTACAACTACTACGACACCTACGAGCGGCCGCGCCAGGGCAGCAGGTACCGGCCCGG
CTACGGCACCGGCTACTTCCAGTACGGTCTGCCCGACCTCGTCCCGGACCCCTACTACATCCAGGCGTCCACCTACGTG
CAGAGGATGTCCATGTACAACCTGCGCTGCGCCGCCGAGGAGAACTGCTTGGCCAGCTCAGCTTATCGGGCGGATGTTA
GAGACTATGACAACCGAGTGCTCCTGAGATTCCCTCAAAGAGTGAAAAACCAAGGAACTTCAGATTTCCTACCAAGCAG
GCCTCGATATTCCTGGGAGTGGCACAGCTGTCACCAGCATTACCACAGCATGGATGAGTTCAGCCACTATGACTTGTTA
GACGCCAGCTCGCACAGAAAAGTTGCTGAAGGACACAAAGCAAGTTTCT
CommentsImages and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 11
stage 12
Blood Islands
Extraembryonic
Head Mesenchyme
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
Sinus Venosus
Ventricles
 

Entry 2

GEISHA IdLOX.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CGGCAGCCGCGCCGCCGCCAGCCCCTCGTCGGCGGCCCCGCGGTCCGGAGGTCCCGGCGACGAGAGCGAGCGGAGCGCC
GGAGGGCTGCCCGCGCCCAGCGGTCTGCGGCCCGGGCGGGAGGACGTGATGGTGGGCGACGACCCCTACAGCCCCTACA
AGTACACGGACGATAACCCCTACTACAACTACTACGACACCTACGAGCGGCCGCGCCAGGGCAGCAGGTACCGGCCCGG
CTACGGCACCGGCTACTTCCAGTACGGTCTGCCCGACCTCGTCCCGGACCCCTACTACATCCAGGCGTCCACCTACGTG
CAGAGGATGTCCATGTACAACCTGCGCTGCGCCGCCGAGGAGAACTGCTTGGCCAGCTCAGCTTATCGGGCGGATGTTA
GAGACTATGACAACCGAGTGCTCCTGAGATTCCCTCAAAGAGTGAAAAACCAAGGAACTTCAGATTTCCTACCAAGCAG
GCCTCGATATTCCTGGGAGTGGCACAGCTGTCACCAGCATTACCACAGCATGGATGAGTTCAGCCACTATGACTTGTTA
GACGCCAGCTCGCACAGAAAAGTTGCTGAAGGACACAAAGCAAGTTTCTATTATGCAACTAACTGGCTACAGATTCAGT
GAAATGCCACTTGTTTTTTGCAGCTTTTTTTGAAGTTTTCATTATTTCCTTCACTTTTCTTCCAACAGTCTTGACTTCA
GCAAAACTTGCATCTTTATCTGATGAGTTCTTATTTATAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.48063

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona