GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MAB21L1
mab-21 like 1

Gene
Official SymbolMAB21L1
Official Full Namemab-21 like 1
CGNC ID12813
also known asputative nucleotidyltransferase MAB21L1|cell fate determination protein|protein mab-21-like 1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204533
PolypeptideNP_989864
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.32
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly44127FBgn0029003
Human4081MIM:601280
Mouse17116ENSMUSG00000056947All phenotypic alleles (1):Targeted, knock-out(1) MGI:1333773
Xenopus780258, 4438911001176
Zebrafish246091ENSDARG00000055089ZDB-GENE-020516-1ZFIN:ZDB-GENE-020516-1
Gene Ontology
Molecular Function
Biological Processcamera-type eye development, embryonic organ development, positive regulation of cell proliferation
Cellular Componentnucleus
Links to other databases
Entrez Gene395208
Ensembl GeneENSGALG00000017059
KEGGgga:395208

Entry 1

GEISHA IdChEST212d24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GTCAAAAAAGAAAAAGAAAGAAAAAAAAAAACCCCAAGGAATACAGCGTAGGCTCTTCACCGAGAAAAGCGAATAAAAG
CCTCAAGCATCGCCATCACCCCTCCGCTCCTCGTCACGGTGTTGCAGGAAAATAATAATAATAACAACCAAATAATAAT
AAAAAATCAATGCGTTTACCCGGAAAGCGAAATTGGCCGTGATTTACCGCGGCTATGAGCACCCCGCCCAGGAACGGCA
CCCACGGATTATAACAAACGCGGTCTTTTTTTCCTGTACCCCCCCCTTCTCCATCGCCCCCCCCCCCCTCCCCGTGAGT
AAACGCTGTTTGGAGACGCCACCTGACCGACCCCGATGTACCTTTTAATTTGTATCAGATATTGTGAGCTCACGTTGTC
TTTTGAAATTGTGGATGTTGGTGTTTTTGTGATTTGGTGACCAGAAGTTAAATTGCCATTTTGGATACTTCAAGGACAT
TTTCTGCTAACGAGAAGATACCATTTGAAAAGGTAGATTTTATCACGGTACTTTTGTTAATTGTCTTTTGAAGTGTCTG
AACTTAACGAGTTTACATTTTTTCGTTTCATATATATTGCTTGTTCTATTTCTAACATTCCATAAATATACTTGAAATG
TTATTTAAATATATTCGAAAGAAATTTGGATTCTGCTTATATAATAACGCTTGAATATTGGAATTATATATTTGAAAAT
GCACTTGAAATACACTGGATAATTACCTTTTGTGATTTAGATTTTAATTTCTGTTGCTGATTTATTTAATTACGAGCTA
ATAAATGAAGTAAAACGCATAAAA
CommentsMaps adjacent to ENSGALG00000017059 MB211 NCBi 395208 Mab-21-like 1 no specific expression detected stages 5-11.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 17
Amnion
Extraembryonic
Lens
Pharyngeal Arches and Clefts
 
19
stage 19
Amnion
Lens
Pharyngeal Arches and Clefts
 

Entry 2

GEISHA IdMAB21.Vieira.2005Data SourcePublication
Complete cDNA Template Probeshow
AGATTGGGGGGAGGCCGGCGTAGCTGATTGGCCGCCGCCCGCGGGAGCCGCGCGTTCCACTCCGGAGGCGGCAGCCCGA
TTCTCCCCGAAGTTGGCTCCCGCCTTAGCAGCCGCATTGGATCCCACAGCCTACTGCGAGACTCCGGTGTACAATCCGG
ATCTCTGCCCCAACATGATCGCGGCCCAGGCCAAGCTGGTGTACCACCTGAACAAGTACTACAACGAGAAGTGCCAAGC
CAGGAAAGCCGCCATCGCCAAGACGATCCGCGAGGTGTGCAAGGTGGTGTCGGACGTGCTGAAGGAGGTGGAGGTGCAG
GAGCCGCGCTTCATCAGCTCCCTCAACGAGATGGACAACCGCTACGAGGGCCTGGAAGTCATCTCCCCCACCGAGTTCG
AGGTGGTGCTCTACCTCAACCAGATGGGGGTCTTCAACTTCGTGGACGACGGCTCCCTGCCGGGCTGCGCCGTGCTGAA
GCTGAGCGACGGCCGCAAGCGGAGCATGTCGCTCTGGGTGGAGTTCATCACGGCCTCGGGGTACCTCTCGGCCCGCAAG
ATCCGCTCCCGCTTCCAGACGCTGGTGGCCCAAGCCGTGGATAAGTGCAGTTACAGGGACGTGGTAAAGATGGTGGCGG
ACACGAGCGAGGTGAAGCTGAGGATCAGGGACAGGTACGTGGTGCAGATCACGCCCGCCTTCAAGTGCACGGGGATCTG
GCCGCGGAGCGCTGCCCACTGGCCGCTGCCCCACATCCCCTGGCCCGGCCCCAACCGCGTGGCCGAGGTGAAGGCGGAG
GGCTTCAACCTGCTCTCCAAGGAGTGCCACTCGCTGGCGGGCAAGCAGAGCTCGGCCGAGAGCGACGCCTGGGTGCTGC
AGTTCGCCGAAGCCGAGAACAGACTGCAGATGGGCGGCTGCAGGAAGAAATGCCTCTCCATCCTCAAAACGCTGCGGGA
CCGGCACCTGGAGCTGCCGGGCCAGCCGCTCAACAACTACCACATGAAGACTCTCGTATCGTACGAATGCGAAAAGCAC
CCGCGGGAGTCGGACTGGGACGAGTCGTGCTTGGGCGATCGGCTCAACGGGATTTTACTGCAGCTCATCTCCTGCCTGC
AGTGCAGGAGGTGCCCGCACTACTTCTTGCCCAACTTAGACCTCTTTCAGGGCAAACCTCACTCGGCCCTGGAAAACGC
GGCCAAACAGACGTGGCGGCTGGCCAGGGAGATACTGACCAACCCGAAAAGTTTGGAGAAACTTTAGAGGGGAGCCCGA
AAAGGGCCCGAACCGGCTTCTGTCCCGACGAAGTTTAAGCTTCCCGTTCGAAAAGTCAGAGATTTCCACTTGACAATGC
AACTCGTGCC
CitationVieira C, Garda AL, Shimamura K, Martinez S. Thalamic development induced by Shh in the chick embryo. Dev Biol. 2005 Aug 15;284(2):351-63.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204533).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
Central Nervous System
Mesencephalon
Pretectum

Entry 3

GEISHA IdMAB21L1.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
TTCATCACGGCCTCGGGGTACCTCTCGGCCCGCAAGATCCGCTCCCGCTTCCAGACGCTGGTGGCCCAAGCCGTGGATA
AGTGCAGTTACAGGGACGTGGTAAAGATGGTGGCGGACACGAGCGAGGTGAAGCTGAGGATCAGGGACAGGTACGTGGT
GCAGATCACGCCCGCCTTCAAGTGCACGGGGATCTGGCCGCGGAGCGCTGCCCACTGGCCGCTGCCCCACATCCCCTGG
CCCGGCCCCAACCGCGTGGCCGAGGTGAAGGCGGAGGGCTTCAACCTGCTCTCCAAGGAGTGCCACTCGCTGGCGGGCA
AGCAGAGCTCGGCCGAGAGCGACGCCTGGGTGCTGCAGTTCGCCGAAGCCGAGAACAGACTGCAGATGGGCGGCTGCAG
GAAGAAATGCCTCTCCATCCTCAAAACGCTGCGGGACCGGCACCTGGAGCTGCCGGGCCAGCCGCTCAACAACTACCAC
ATGAAGACTCTCGTATCGTACGAATGCGAAAAGCACCCGCGGGAGTCGGACTGGGACGAGTCGTGCTTGGGCGATCGGC
TCAACGGGATTTTACTGCAGCTCATCTCCTGCCTGCAGTGCAGGAGGTGCCCGCACTACTTCTTGCCCAACTTAGACCT
CTTTCAGGGCAAACCTCACTCGGCCCTGGAAAACGCGGCCAAACAGACGTGGCGGCTGGCCAGGGAGATACTGGACCAA
CCCGAAAAGTTTGGAGAAACTTTAGAGGGGAGCCCGAAAAGGGCCCGAACCG
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST386j5. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Extraembryonic
Extraembryonic Blood Vessels
Eye
Mesencephalon
Proepicardium
extraembryonic endoderm
extraembryonic mesoderm
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.32

Mouse

EmageMGI:1333773
EurexpressMGI:1333773
MGI GXDMGI:1333773

Frog

Xenbase1001176

Fruit Fly

BDGPFBgn0029003

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020516-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona