GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MB
myoglobin

Gene
Official SymbolMB
Official Full Namemyoglobin
CGNC ID9519
also known asmyoglobin
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001167752
PolypeptideNP_001161224
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1960
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4151ENSG00000198125MIM:160000
Mouse17189ENSMUSG00000018893All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:96922
Xenopus
Zebrafish393558ENSDARG00000031952ZDB-GENE-040426-1430ZFIN:ZDB-GENE-040426-1430
Gene Ontology
Molecular Functionheme binding, iron ion binding, oxygen binding, oxygen transporter activity
Biological Processbrown fat cell differentiation, enucleate erythrocyte differentiation, heart development, more...response to hypoxia
Cellular Component
Links to other databases
Entrez Gene418056
Ensembl GeneENSGALG00000012541
KEGGgga:418056
GEISHA IdMB.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
GGCAACCGCCATAGGCAGCACTTGAGACCTATCTATCTGTCCCAGCCACCGGTGAACCATGGGGCTCAGCGACCAGGAG
TGGCAACAAGTCCTCACCATCTGGGGAAAAGTGGAGGCCGACATTGCTGGCCATGGACACGAGGTTCTGATGAGACTTT
TCCATGACCACCCTGAGACTTTGGATCGCTTTGATAAGTTCAAAGGCCTGAAGACCCCTGATCAGATGAAGGGCTCTGA
AGATCTGAAGAAACATGGAGCTACTGTCCTCACCCAGCTTGGCAAAATCCTGAAGCAGAAGGGTAATCATGAGTCAGAG
CTGAAGCCCCTGGCTCAAACCCATGCCACGAAGCACAAAATCCCAGTCAAATATCTGGAGTTCATTTCTGAAGTCATTA
TCAAGGTCATTGCTGAAAAACATGCCGCAGACTTTGGGGCCGATTCCCAGGCTGCCATGAAGAAGGCTCTGGAGCTGTT
CCGAAATGACATGGCCAGCAAGTACAAGGAGTTTGGTTTCCAGGGTTAGCATGTACGCAGAAGGACACCACGACGGAGG
CCTTGCCATGCATCTCAGAGTAGCTTCCTCAGCACTATTCTGGACATCTTCCAACTGACCATCCACGACGTGCGGGAAT
GCTTCAGTGAGAGGCCAAGAGTCACCCTAGGCAGCGCAGAGGCACTCAGAGTGATGTCCGTGATAAATTGTTGTCCTTT
CCTGGCTTCATGTATGCAAAAGAAATAATCTGTTTTCTTAGAATACATAATGTACGGGGTTATTTGCCAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST501h20. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 10
stage 12
stage 12
stage 12
stage 12
Atria
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1960

Mouse

EmageMGI:96922
EurexpressMGI:96922
MGI GXDMGI:96922

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-1430
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona