GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MEIS1
Meis homeobox 1

Gene
Official SymbolMEIS1
Official Full NameMeis homeobox 1
CGNC ID6659
also known ashomeobox protein Meis1|myeloid ecotropic viral insertion site-1a protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001139477
PolypeptideNP_001132949
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.324
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395589
Ensembl Gene
KEGGgga:395589

Entry 1

GEISHA IdChEST1014a13Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCCAACTGCTTTCTCTTTAAAGGTGAAGGGTAAGGGTGTGTTAGATGCTGGAACAGCCATGCCCTCATGATATTTGTGG
CTACTTTGGGAAAGATGCCACGCTTTTTATGTTGCTGTTTTGTCCTTATCTGGATCATCATCATCACCTGTGCTGGGGG
AAGCTACACTGTTGTCCGAACCGTCACCTTGCTCACTGCTGTTGTCCCCACTGTGTGATGTGTGTCCCCCACTGGAGGG
CCCAGGGGTTCCCCCGGAGCGCGTTGATGCCGTGTCTTCCTGGTCTCTGTTCCAGGAGGGCTGATCAGTGAGGTTTGCC
GACCGCGTTATGTCCTCGCTGTCCGATTTTGATCCGCCCTCTCTATCGTCTATGACCAAATCGATAGGCATTTTTCCTT
TCAAACAGCTTATATACCGGTGGCAGAAATTGTCACATAATTCAAGTACCTTCTCTAATTCCAACTGATGAAACCTTTT
TACTTGTATGGCTTGGATCATCAACTTATCCAGTTCGGGATTACAGGAAAAGAGGGGTTTCTCTGCTCAGATCTGTTTG
GCGAACACTGCTATGTCTTCATTGAAAGACTCAGAGGAGCAAACATCGCCTCTCGCTACCCCTGGCTCCCTGGGCGTGC
ATGTGGCTAATTCATATTTCTCAAAAAATCACTGCTAAAAGATGAGAAAGGAGGTGTCTGTATTAATGGCATTCTTTAT
CTCATCTTGAAGGCATCGTTTAAACAAGCGCCCATGGCGGGGGGCAAGACCTTTGCGATGGCTGACTGCAGGTACTGTC
GAAAGTGAAACGACAGCCTTTGGTTCATGAGGTGAACAGACTGAATGGGGCCGGC
CommentsNo specific expression detected for stages 3-22.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
Extraembryonic
Pharyngeal Arches and Clefts
Widespread Expression
weak

Entry 2

GEISHA IdMeis1.Tiecke.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGAGAGAGGAGCGTGATGCTCTGCTCCCTGCTTCCGCATACGGGAACTTGGCTAATGCAGTCAGAGAAGTCGGCAGAG
GGAAAAACACTGCCATGGGTTTGGTGCCGGGGAGCCGTCTCCTCATGGCCGAGAGTGATGTGGGATGTGCGGAGTTCCC
CCTGGTTGCCTTGAAGGCCATCAGCAACGGGGGCAAAGCCGTGCTGAGCGGCTGGGCTCCCTCCTGGAACAGAGACCAC
GACGACACGGCATCAACGCGCTCCGGGGGAACCCCCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACA
GCAGTGAGCAAGGTGACGGCTTGGACAACAGTGTAGCTTCCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAA
AAAGCGACATAAAAAGCGTGGCATCTTTCCCAAAGTAGCCACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACA
CACCCTTACCCTTCAGAAGAACAGAAAAAGCAGTTGGCACAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGT
TTATTAATGCTAGAAGAACCCTTTTTAAGCCCATGATAGACCAGTCCAATCGAGCAGTAAGCCAAGGGACGCCCTACAA
CCCCGACGGGCAGCCAATGGGAGGCTTCGTGATGGATGGCCAGCAGCACATGGGCATCCGAGCGCCAGGGCTGCAAAGT
GTGCCAGGGGATTATGTGTCTCGGGGTAGTCCAATGGGTATGAACATGGGACAGCCAAGCTATACCCCGCCCCAGATGC
CCCCCCATCCCGCTCAGCTGCGTCACGGCCCCCCCATGCATACCTACATTCCTGGACACCCTCACCACCCAGCGATGAT
GATGCATGGAGGACCACCCCACCCCGGAATGCCCATGTCAGCATCCAGCCCCACAATGCTTCATCCCGGCGAGCCGGCG
GCGAGCGGACAAGTGATGGACATTCATGCTCAGTAG
CitationTiecke E, Bangs F, Blaschke R, Farrell ER, Rappold G, Tickle C. Expression of the short stature homeobox gene Shox is restricted by proximal and distal signals in chick limb buds and affects the length of skeletal elements. Dev Biol. 2006 Oct 15;298(2):585-96. Epub 2006 Jul 12.
CopyrightReprinted from Developmental Biology, 298, Eva Tiecke, Fiona Bangs, Rudiger Blaschke, Elizabeth R. Farrell, Gudrun Rappold, and Cheryll Tickie, Expression of the short stature homebox gene Shox is restricted by proximal and distal signals in chick limb buds and affects the length of skeletal elements, 585-596, 2006, with permission from Elsevier. Copyright © 2006 Elsevier B.V. All rights reserved.
CommentsAuthors indicate probe information can be found in Mercader et al., 1999, who say: cMeis1: +439 to +1491. These were extracted from Acc # XM_001233136).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-35
stage 35
 Anatomy.

Entry 3

GEISHA IdMEIS1.Sanchez-Guardado.2011Data SourcePublication
Complete cDNA Template Probeshow
CTCCACTCGCACCAGTACCCGCACGCCGCCCACGCCAACGCCATGCCCCCCGCCATGGGCGCCTCGGTCAACGATGCCC
TCAAGAGAGATAAAGATGCCATCTACGGACACCCCCTGTTCCCTCTTTTAGCACTGATTTTTGAGAAATGTGAATTAGC
CACATGCACGCCCACGGAGCCCGGGGTAGCGGGAGGCGATGTTTGCTCCTCCGAGTCTTTCAATGAAGACATAGCAGTG
TTCGCCAAACAGATCCGAGCAGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGATAACTTGATGATCCAAGCCATAC
AAGTATTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACGAATTATGTGACAATTTCTGCCACCGGTATATTAGCTG
TTTGAAAGGAAAAATGCCTATCGATTTGGTCATAGACGATAGAGAGGGCGGATCAAAATCGGACAGCGAGGACATAACG
CGGTCGGCAAACCTCACCGATCAGCCCTCCTGGAACAGAGACCACGACGACACGGCATCAACGCGCTCCGGGGGAACCC
CCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAA
CitationSánchez-Guardado LÓ, Ferran JL, Rodríguez-Gallardo L, Puelles L, Hidalgo-Sánchez M. Meis gene expression patterns in the developing chicken inner ear. J Comp Neurol. 2011 Jan 1;519(1):125-47.
Copyright© 2010 Wiley-Liss, Inc.
CommentsThe sequence was obtained from NCBI (acc #. AF202933) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
Ear/Otic Placode
Neural Plate/Tube
caudal level
intermediate level
rostral level
13-18
stage 14
stage 14
stage 14
Ear/Otic Placode
Neural Plate/Tube
 
19-24
stage 20
stage 20
stage 20
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placode
Neural Plate/Tube
ac, anterior cristae; vp, vertical pouch
bp, basilar papilla; hp, horizontal pouch; vp, vertical pouch
hp, horizontal pouch
vp, vertical pouch
vp, vertical pouch; bp, basilar papilla
vp, vertical pouch; hp, horizontal pouch
vp, vertical pouch; lc, lateral cristae
25-30
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placode
Neural Plate/Tube
 
31-34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
Ear/Otic Placode
 

Entry 4

GEISHA IdMEIS1.Merchan.2011Data SourcePublication
Complete cDNA Template Probeshow
GTGTTCGCCAAACAGATCCGAGCAGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGATAACTTGATGATCCAAGCCA
TACAAGTATTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACGAATTATGTGACAATTTCTGCCACCGGTATATTAG
CTGTTTGAAAGGAAAAATGCCTATCGATTTGGTCATAGACGATAGAGAGGGCGGATCAAAATCGGACAGCGAGGACATA
ACGCGGTCGGCAAACCTCACCGATCAGCCCTCCTGGAACAGAGACCACGACGGCACGGCATCAACGCGCTCCGGGGGAA
CCCCCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACAGCAGTGAGCAAGGTGACGGCTTGGACAACAG
TGTAGCTTCCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAAAAAGCGACATAAAAAGCGTGGCATCTTTCCC
AAAGTAGCCACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACACACCCTTACCCTTCAGAAGAACAGAAAAAGC
AGTTGGCACAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGTTTATTAATGCTAGAAGAAGAATAGTTCAGCC
CATGATAGACCAGTCCAATCGAGCAGTAAGCCAAGGGACGCCCTACAACCCCGACGGGCAGCCAATGGGAGGCTTCGTG
ATGGATGGCCAGCAGCACATGGGCATCCGAGCGCCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAGG
CitationMerchán,P, Bardet, SM, Puelles, L, Ferran, JL, Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos. Front Neuroanat. 2011; 5: 23. Prepublished online 2010 December 29. Published online 2011 April 5
CopyrightCopyright © 2011 Merchán, Bardet, Puelles and Ferran.
CommentsPrimers: Forward: 5′-GTGTTCGCCAAACAGATCCG-3′; Reverse: 5′-CCTCCATGCCCATATTCATGC-3′
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 27
stage 27
stage 27
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
Midbrain

CoP commissural pretectum,
Hab habenular region
JcP juxtacommissural pretectum,
OT optic tectum
PcP precommissural pretectum,
Quail
Th Thalamus,
mes mesencephalon,

Entry 5

GEISHA IdMEIS1.Sanchez-Guardado.2011BData SourcePublication
Complete cDNA Template Probeshow
ATGAGAGAGGAGCGTGATGCTCTGCTCCCTGCTTCCGCATACGGGAACTTGGCTAATGCAGTCAGAGAAGTCGGCAGAG
GGAAAAACACTGCCATGGGTTTGGTGCCGGGGAGCCGTCTCCTCATGGCCGAGAGTGATGTGGGATGTGCGGAGTTCCC
CCTGGTTGCCTTGAAGGCCATCAGCAACGGGGGCAAAGCCGTGCTGAGCGGCTGGGCTCCCTCCTGGAACAGAGACCAC
GACGACACGGCATCAACGCGCTCCGGGGGAACCCCCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACA
GCAGTGAGCAAGGTGACGGCTTGGACAACAGTGTAGCTTCCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAA
AAAGCGACATAAAAAGCGTGGCATCTTTCCCAAAGTAGCCACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACA
CACCCTTACCCTTCAGAAGAACAGAAAAAGCAGTTGGCACAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGT
TTATTAATGCTAGAAGAACCCTTTTTAAGCCCATGATAGACCAGTCCAATCGAGCAGTAAGCCAAGGGACGCCCTACAA
CCCCGACGGGCAGCCAATGGGAGGCTTCGTGATGGATGGCCAGCAGCACATGGGCATCCGAGCGCCAGGGCTGCAAAGT
GTGCCAGGGGATTATGTGTCTCGGGGTAGTCCAATGGGTATGAACATGGGACAGCCAAGCTATACCCCGCCCCAGATGC
CCCCCCATCCCGCTCAGCTGCGTCACGGCCCCCCCATGCATACCTACATTCCTGGACACCCTCACCACCCAGCGATGAT
GATGCATGGAGGACCACCCCACCCCGGAATGCCCATGTCAGCATCCAGCCCCACAATGCTTCATCCCGGCGAGCCGGCG
GCGAGCGGACAAGTGATGGACATTCATGCTCAGTAG
CitationSánchez-Guardado LÓ, Irimia M, Sánchez-Arrones L, Burguera D, Rodríguez-Gallardo L, Garcia-Fernández J, Puelles L, Ferran JL, Hidalgo-Sánchez M. Distinct and redundant expression and transcriptional diversity of MEIS gene paralogs during chicken development. Dev Dyn. 2011 Jun;240(6):1475-92.
CopyrightCopyright © 2011 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # XM_001233136.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Unlabeled
 
4-6
stage 4
stage 5
Early Endoderm
Early Mesoderm
Neural Plate/Tube
Primitive Streak
stage HH4+
7-12
stage 7
stage 8
stage 8
stage 11
stage 11
Anterior Intestinal Portal
Dermomyotome
Early Endoderm
Early Mesoderm
Ectoderm
Endoderm
Hindbrain
Lateral Plate Mesoderm
Midbrain
Primitive Streak
Retina
Sclerotome
Somites
Spinal Cord
Splanchnic Mesoderm
Surface Ectoderm
 
13-18
stage 14
stage 14
stage 16
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
Aorta
Atria
Diencephalon
Ear/Otic Placode
Esophagus
Eye
Forebrain
Hindbrain
Hindgut
Isthmus/MHB
Lateral Plate Mesoderm
Lens
Limb Buds
Lung
Mesencephalon
Mesonephros
Midbrain
Nasal Placode/Nerve
Pancreas
Pharyngeal Arches and Clefts
Pharynx
Retina
Rhombomeres
Spinal Cord
Telencephalon
Trunk Mesenchyme
PT, pretectum
Rp, Rathke's pouch
STAGE HH18-20
STAGE HH18-HH20
hyp, hypothalamus
lb, lung buds
mp, mandibular process
pe, pigmented epithelium
td, thyro-glossal duct

Entry 6

GEISHA IdMEIS1.Huber.2012Data SourcePublication
Complete cDNA Template Probeshow
TCACGGAGGATTTATTAGAAGTTGAAGTAGAAAGGGAGCGAGCAGGCCGATGGCGCAAAGGTACGACGAGCTGCCCCAC
TACGGCGGCATGGAGGGGGTGGGCATCCCCACCACCATGTACGGGGACCCGCACGGCGCCCGCCCCATGCGGCCCGTGC
ACCACCTGAACCACGGGCCGCCGCTCCACTCGCACCAGTACCCGCACGCCGCCCACGCCAACGCCATGCCCCCCGCCAT
GGGCGCCTCGGTCAACGATGCCCTCAAGAGAGATAAAGATGCCATCTACGGACACCCCCTGTTCCCTCTTTTAGCACTG
ATTTTTGAGAAATGTGAATTAGCCACATGCACGCCCAGGGAGCCCGGGGTAGCGGGAGGCGATGTTTGCTCCTCCGAGT
CTTTCAATGAAGACATAGCAGTGTTCGCCAAACAGATCCGAGCAGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGA
TAACTTGATGATCCAAGCCATACAAGTATTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACGAATTATGTGACAAT
TTCTGCCACCGGTATATTAGCTGTTTGAAAGGAAAAATGCCTATCGATTTGGTCATAGACGATAGAGAGGGCGGATCAA
AATCGGACAGCGAGGACATAACGCGGTCGGCAAACCTCACCGATCAGCCCTCCTGGAACAGAGACCACGACGGCACGGC
ATCAACGCGCTCCGGGGGAACCCCCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACAGCAGTGAGCAA
GGTGACGGCTTGGACAACAGTGTAGCTTCCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAAAAAGCGACATA
AAAAGCGTGGCATCTTTCCCAAAGTAGCCACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACACACCCTTACCC
TTCAGAAGAACAGAAAAAGCAGTTGGCACAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGTTTATTAATGCT
AGAAGAAGAATAGTTCAGCCCATGATAGACCAGTCCAATCGAGCAGTAAGCCAAGGGACGCCCTACAACCCCGACGGGC
AGCCAATGGGAGGCTTCGTGATGGATGGCCAGCAGCACATGGGCATCCGAGCGCCAGGACCTATGAGTGGAATGGGCAT
GAATATGGGCATGGAGGGGCAGTGGCACTACATGTAACCTTCACC
CitationHuber L, Ferdin M, Holzmann J, Stubbusch J, Rohrer H. HoxB8 in noradrenergic specification and differentiation of the autonomic nervous system. Dev Biol. 2012 Mar 1;363(1):219-33. Epub 2011 Dec 24.
CopyrightCopyright © 2011 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_001139477.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-29
stage 27
stage 27
stage 27
stage 29
Esophagus
Peripheral Nervous System
ciliary ganglia
enteric ganglia
sympathetic ganglia

Entry 7

GEISHA IdMEIS1.Ferran.2007Data SourcePublication
Complete cDNA Template Probeshow
CTCGCACCAGTACCCGCACGCCGCCCACGCCAACGCCATGCCCCCCGCCATGGGCGCCTCGGTCAACGATGCCCTCAAG
AGAGATAAAGATGCCATCTACGGACACCCCCTGTTCCCTCTTTTAGCACTGATTTTTGAGAAATGTGAATTAGCCACAT
GCACGCCCACGGAGCCCGGGGTAGCGGGAGGCGATGTTTGCTCCTCCGAGTCTTTCAATGAAGACATAGCAGTGTTCGC
CAAACAGATCCGAGCAGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGATAACTTGATGATCCAAGCCATACAAGTA
TTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACGAATTATGTGACAATTTCTGCCACCGGTATATTAGCTGTTTGA
AAGGAAAAATGCCTATCGATTTGGTCATAGACGATAGAGAGGGCGGATCAAAATCGGACAGCGAGGACATAACGCGGTC
GGCAAACCTCACCGATCAGCCCTCCTGGAACAGAGACCACGACGACACGGCATCAACGCGCTCCGGGGGAACCCCCGGG
CCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACAGCAGTGAGCAAGGTGACGGCTTGGACAACAGTGTAGCTT
CCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAAAAAGCGACATAAAAAGCGTGGCATCTTTCCCAAAGTAGC
CACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACACACCCTTACCCTTCAGAAGAACAGAAAAAGCAGTTGGCA
CAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGTTTATTAATGCTAGAAGAAGAAT
CitationFerran JL, Sánchez-Arrones L, Sandoval JE, Puelles L. A model of early molecular regionalization in the chicken embryonic pretectum. J Comp Neurol. 2007 Dec 1;505(4):379-403.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
CommentsThe sequence below was obtained from NCBI (acc #: AF202933 - Showing 596 bp region from base 121 to 716) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
Diencephalon
 
19-24
stage 24
stage 24
Diencephalon
Hypothalamus
 
25
stage 25
Diencephalon
 

Entry 8

GEISHA IdMEIS1.Mercader.2000Data SourcePublication
Complete cDNA Template Probeshow
AGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGATAACTTGATGATCCAAGCCATACAAGTATTAAGGTTTCATCTG
TTGGAATTAGAGAAGGTACACGAATTATGTGACAATTTCTGCCACCGGTATATTAGCTGTTTGAAAGGAAAAATGCCTA
TCGATTTGGTCATAGACGATAGAGAGGGCGGATCAAAATCGGACAGCGAGGACATAACGCGGTCGGCAAACCTCACCGA
TCAGCCCTCCTGGAACAGAGACCACGACGGCACGGCATCAACGCGCTCCGGGGGAACCCCCGGGCCCTCCAGTGGGGGA
CACACATCACACAGTGGGGACAACAGCAGTGAGCAAGGTGACGGCTTGGACAACAGTGTAGCTTCCCCCAGCACAGGTG
ATGATGATGATCCAGATAAGGACAAAAAGCGACATAAAAAGCGTGGCATCTTTCCCAAAGTAGCCACAAATATCATGAG
GGCATGGCTGTTCCAGCATCTAACACACCCTTACCCTTCAGAAGAACAGAAAAAGCAGTTGGCACAAGACACAGGGCTC
ACTATACTTCAAGTGAACAATTGGTTTATTAATGCTAGAAGAAGAATAGTTCAGCCCATGATAGACCAGTCCAATCGAG
CAGTAAGCCAAGGGACGCCCTACAACCCCGACGGGCAGCCAATGGGAGGCTTCGTGATGGATGGCCAGCAGCACATGGG
CATCCGAGCGCCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAGGGGCAGTGGCACTACATGTAACCTTCA
CC
CitationMercader N, Leonardo E, Piedra ME, Martínez-A C, Ros MA, Torres M. Opposing RA and FGF signals control proximodistal vertebrate limb development through regulation of Meis genes. Development. 2000 Sep;127(18):3961-70.
Copyright© The Company of Biologists Limited 2000
CommentsThe sequence below was obtained from NCBI (acc # NM_001139477.1 - Showing 792 bp region from base 439 to 1491) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 19
stage 19
stage 19
stage 19
stage 19
stage 19
stage 20
stage 20
stage 20
stage 20
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
Lateral Plate Mesoderm
Leg
Limb Buds
Neural Plate/Tube
Somites
Wing
Stages 20-22 embryos
control embryo
left side = control embryo
left side = control side
left side = control side
left wing = control side
right side = -AER
right side = -AET +RAA
right side = BMP2 bead
right side = FGF1 bead
right side = FGF8 +RA bead
right side = FGF8 +RAA bead
right side = FGF8 bead
stage 19-21 embryos
stage 19-21 limbs

Entry 9

GEISHA IdMeis1.Afrakhte.2004Data SourcePublication
Complete cDNA Template Probeshow
TCACGGAGGATTTATTAGAAGTTGAAGTAGAAAGGGAGCGAGCAGGCCGATGGCGCAAAGGTACGACGAGCTGCCCCAC
TACGGCGGCATGGAGGGGGTGGGCATCCCCACCACCATGTACGGGGACCCGCACGGCGCCCGCCCCATGCGGCCCGTGC
ACCACCTGAACCACGGGCCGCCGCTCCACTCGCACCAGTACCCGCACGCCGCCCACGCCAACGCCATGCCCCCCGCCAT
GGGCGCCTCGGTCAACGATGCCCTCAAGAGAGATAAAGATGCCATCTACGGACACCCCCTGTTCCCTCTTTTAGCACTG
ATTTTTGAGAAATGTGAATTAGCCACATGCACGCCCAGGGAGCCCGGGGTAGCGGGAGGCGATGTTTGCTCCTCCGAGT
CTTTCAATGAAGACATAGCAGTGTTCGCCAAACAGATCCGAGCAGAGAAACCCCTCTTTTCCTCTAATCCCGAACTGGA
TAACTTGATGATCCAAGCCATACAAGTATTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACGAATTATGTGACAAT
TTCTGCCACCGGTATATTAGCTGTTTGAAAGGAAAAATGCCTATCGATTTGGTCATAGACGATAGAGAGGGCGGATCAA
AATCGGACAGCGAGGACATAACGCGGTCGGCAAACCTCACCGATCAGCCCTCCTGGAACAGAGACCACGACGGCACGGC
ATCAACGCGCTCCGGGGGAACCCCCGGGCCCTCCAGTGGGGGACACACATCACACAGTGGGGACAACAGCAGTGAGCAA
GGTGACGGCTTGGACAACAGTGTAGCTTCCCCCAGCACAGGTGATGATGATGATCCAGATAAGGACAAAAAGCGACATA
AAAAGCGTGGCATCTTTCCCAAAGTAGCCACAAATATCATGAGGGCATGGCTGTTCCAGCATCTAACACACCCTTACCC
TTCAGAAGAACAGAAAAAGCAGTTGGCACAAGACACAGGGCTCACTATACTTCAAGTGAACAATTGGTTTATTAATGCT
AGAAGAAGAATAGTTCAGCCCATGATAGACCAGTCCAATCGAGCAGTAAGCCAAGGGACGCCCTACAACCCCGACGGGC
AGCCAATGGGAGGCTTCGTGATGGATGGCCAGCAGCACATGGGCATCCGAGCGCCAGGACCTATGAGTGGAATGGGCAT
GAATATGGGCATGGAGGGGCAGTGGCACTACATGTAACCTTCACC
CitationAfrakhte M, Schultheiss TM. Construction and analysis of a subtracted library and microarray of cDNAs expressed specifically in chicken heart progenitor cells. Dev Dyn. 2004 Jun;230(2):290-8.
CopyrightCopyright © 2004 Wiley‐Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (Acc. # NM_001139477.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Early Mesoderm
 
31-44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.324

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona