GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MEIS2
Meis homeobox 2

Gene
Official SymbolMEIS2
Official Full NameMeis homeobox 2
CGNC ID49388
also known asMeis2a.1, Meis2a.2, homeobox protein Meis2|Meis1, myeloid ecotropic viral integration site 1 homolog 2|homeoprotein Meis2a.1|homeoprotein Meis2a.2|myeloid ecotropic viral insertion site-2a protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204803
PolypeptideNP_990134
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4046
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4212ENSG00000134138MIM:601740
Mouse17536ENSMUSG00000027210All phenotypic alleles (1):Targeted, knock-out(1) MGI:108564
Xenopus100036664, 398167487674
Zebrafish170454, 30066ENSDARG00000077840ZDB-GENE-020122-2, ZDB-GENE-000210-23ZFIN:ZDB-GENE-020122-2, ZFIN:ZDB-GENE-000210-23
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395588
Ensembl Gene
KEGGgga:395588

Entry 1

GEISHA IdMEIS2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTCCGCTGTCAACGACGCTC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGAAGTCCTGTGTCTTGGGCTAACTGcDNA Template Length756
Forward cDNA Template Probeshow
TTTCCCCCTTTTTCGCTCTCGAAGGAATGGATGTGTGAGAGCTGGAAAACCATGCTCTCATGATATTTGTTGCTACTTT
GGGGAAAATGCCTCTTTTCTTCTGTCGCTTTTTGTCCTTGTCTGGGTCATCATCATCCCCAGTACCAGGTGAGGCTACA
CTGTTGTCTAAACCATCCCCTTGCTCGCTGCTGTTGTCTCCACTCTGGGAAGCATGGCCCCCACTGGAGGGCCCCGGTG
TGCCTGCCGAGTGCGTTGAGGTTGCATCATCGTGGTCTCTCCAAGATGAAGGATTATGGTCGGCTAAATTTGTGGAAGA
TCCTGAGAGTTCCTCGTGGTCTGACTTGGAGCTGCCATCCCTTTCATCGATAACGAGGTCTATTGGCATTTTTCCTTTC
AAACAACTAATGTACCGATGGCAGAAGTTATCGCACAATTCGTGAACCTTCTCTAACTCCAGGAGGTGGAACCTTAGTA
CTTGTATTGCTTGGATCATCAAATTGTCCAACTCTGGGTTTGAAGAAAAAAGTGGTTTTTCAGCGCGGACCTGCTTGGC
GAAGACGGCGATGTCCTCGTTGAAGGAGTCGGAGGAGCAGACGTCCCCGCCGGCCACGCCGGGCTCCCGGGGCGTGCAG
GTCGCCAGCTCGCACTTCTCAAAGACCAGGGCGAGGAGGGGAAACANCGGGTGCCCGTAAATCGCATCCTTGTCCCGCT
TCAAAGCGTCGTTGACAGCAGAAAAAC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
stage 6
stage 6
Early Mesoderm
Endoderm
Epiblast
Germinal Crescent
Lateral Plate Mesoderm
Primitive Streak
 
7-12
stage 10
stage 10
Anterior Intestinal Portal
Forebrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Somites
 
13-18
stage 17
stage 18
Endoderm
Eye
Heart
Hindbrain
Limb Buds
Mesencephalon
Nasal Placode/Nerve
Neural Plate/Tube
Pharyngeal Arches and Clefts
Somatic Mesoderm
Somites
Telencephalon
Trunk Mesenchyme
 
19-24
stage 20
stage 20
stage 21
stage 21
stage 23
stage 23
stage 24
stage 24
stage 24
Endoderm
Eye
Heart
Hindbrain
Leg
Mesencephalon
Nasal Placode/Nerve
Neural Plate/Tube
Pharyngeal Arches and Clefts
Somatic Mesoderm
Somites
Telencephalon
Trunk Mesenchyme
Wing
 

Entry 2

GEISHA IdMEIS2.Sanchez-Guardado.2011Data SourcePublication
Complete cDNA Template Probeshow
TACACGCCGGACAGCACTACGGCGCCCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGA
CGCTCTGAAGCGGGACAAGGATGCGATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAG
CTGGCGACCTGCACGCCCCGGGAGCCCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCG
CCGTCTTCGCCAAGCAGGTCCGCGCTGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGC
AATACAAGTACTAAGGTTCCACCTCCTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATT
AGTTGTTTGAAAGGGAAAATGCCAATAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAAC
TCTCAGGATCTTCCACAAATTTAGCCGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTC
GGCAGGCACACCGGGGCCCTCCAGTGGGGGCCATGCTTCCCA
CitationSánchez-Guardado LÓ, Ferran JL, Rodríguez-Gallardo L, Puelles L, Hidalgo-Sánchez M. Meis gene expression patterns in the developing chicken inner ear. J Comp Neurol. 2011 Jan 1;519(1):125-47.
Copyright© 2010 Wiley-Liss, Inc.
CommentsThe sequence below was obtained from NCBI (acc. #: AF199011) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
Ear/Otic Placode
Head Mesenchyme
Neural Plate/Tube
Splanchnic Mesoderm
Unlabeled
caudal level
intermediate level
rostral level
13-18
stage 14
stage 14
stage 14
Ear/Otic Placode
Head Mesenchyme
Neural Plate/Tube
 
19-24
stage 20
stage 20
stage 20
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placode
Neural Plate/Tube
vp, vertical pouch
vp, vertical pouch; hp, horizonatal pouch
vp, vertical pouch; hp, horizontal pouch
25-30
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placode
Neural Plate/Tube
Unlabeled
 
31-34
stage 34
stage 34
stage 34
stage 34
Ear/Otic Placode
 

Entry 3

GEISHA IdMEIS2.Merchan.2011Data SourcePublication
Complete cDNA Template Probeshow
ATGGCGCAAAGGTACGATGAGCTGCCCCACTACGGCGGGATGGACGGCGTAGGGGTGCCGGCGTCCATGTACGGGGACC
CGCACGCCCCCCGGCCGATCCCCCCGGTGCACCACCTCAACCATGGGCCGCCGCTACACGCCGGACAGCACTACGGCGC
CCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGACGCTCTGAAGCGGGACAAGGATGCG
ATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACGCCCCGGGAGC
CCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCGCCGTCTTCGCCAAGCAGGTCCGCGC
TGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGCAATACAAGTACTAAGGTTCCACCTC
CTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATTAGTTGTTTGAAAGGGAAAATGCCAA
TAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCTCAGGATCTTCCACAAATTTAGC
CGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGCAGGCACACCGGGGCCCTCCAGT
GGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGACAACAGTGTAGCCTCACCTGGTA
CTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATAT
CATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAAGAAACAGTTAGCCCAAGACACA
GGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCTATGATTGACCAGTCAA
ATCGAGCAGGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTT
TGTATTGGATGGTCAGCAGCACATGGGAATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATGTAACCTTCATCTTGTAAATCAGTCGCAAA
CitationMerchán,P, Bardet, SM, Puelles, L, Ferran, JL, Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos. Front Neuroanat. 2011; 5: 23. Prepublished online 2010 December 29. Published online 2011 April 5
CopyrightCopyright © 2011 Merchán, Bardet, Puelles and Ferran.
CommentsPrimers: Forward: 5′-ATGGCGCAAAGGTACGATGAG-3′; Reverse: 5′-TTGCGACTGATTTACAAGAT-3′.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
stage 28
Midbrain
CoP commissural pretectum,
Double Label
Double label
Hab habenular region
JcP juxtacommissural pretectum,
OT optic tectum
PcP precommissural pretectum,
Quail
Th Thalamus,
mes mesencephalon,

Entry 4

GEISHA IdMEIS2.Sanchez-Guardado.2011BData SourcePublication
Complete cDNA Template Probeshow
ATGGCGCAAAGGTACGATGAGCTGCCCCACTACGGCGGGATGGACGGCGTAGGGGTGCCGGCGTCCATGTACGGGGACC
CGCACGCCCCCCGGCCGATCCCCCCGGTGCACCACCTCAACCATGGGCCGCCGCTACACGCCGGACAGCACTACGGCGC
CCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGACGCTCTGAAGCGGGACAAGGATGCG
ATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACGCCCCGGGAGC
CCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCGCCGTCTTCGCCAAGCAGGTCCGCGC
TGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGCAATACAAGTACTAAGGTTCCACCTC
CTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATTAGTTGTTTGAAAGGGAAAATGCCAA
TAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCTCAGGATCTTCCACAAATTTAGC
CGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGCAGGCACACCGGGGCCCTCCAGT
GGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGACAACAGTGTAGCCTCACCTGGTA
CTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATAT
CATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAAGAAACAGTTAGCCCAAGACACA
GGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCTATGATTGACCAGTCAA
ATCGAGCAGGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTT
TGTATTGGATGGTCAGCAGCACATGGGAATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATGTAACCTTCATCTTGTAAATCAGTCGCAAA
CitationSánchez-Guardado LÓ, Irimia M, Sánchez-Arrones L, Burguera D, Rodríguez-Gallardo L, Garcia-Fernández J, Puelles L, Ferran JL, Hidalgo-Sánchez M. Distinct and redundant expression and transcriptional diversity of MEIS gene paralogs during chicken development. Dev Dyn. 2011 Jun;240(6):1475-92.
CopyrightCopyright © 2011 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204803.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Hensen's Node
Stage HH3d
4-6
stage 4
stage 5
Early Endoderm
Early Mesoderm
Epiblast
Stage HH4+
Stage HH5+
pm, precardiac mesoderm
7-12
stage 7
stage 8
stage 8
stage 11
stage 11
Anterior Intestinal Portal
Diencephalon
Early Endoderm
Early Mesoderm
Eye
Foregut
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Pronephros
Rhombomeres
Sclerotome
Somatic Mesoderm
Somites
Spinal Cord
Splanchnic Mesoderm
pm, precardiac mesoderm
13-18
stage 14
stage 14
stage 16
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
Atria
Cranial Ganglia
Dermomyotome
Duodenum
Ear/Otic Placode
Esophagus
Eye
Face Mesenchyme
Hindbrain
Intermediate Mesoderm
Isthmus/MHB
Lateral Plate Mesoderm
Limb Buds
Mesencephalon
Nasal Placode/Nerve
Notochord
Pancreas
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Pharynx
Rhombomeres
Sinus Venosus
Spinal Cord
Stomach
Tail
Telencephalon
Trunk Mesenchyme
Widespread Expression
stage HH18-20

Entry 5

GEISHA IdMEIS2.Bobak.2009Data SourcePublication
Complete cDNA Template Probeshow
ATGGCGCAAAGGTACGATGAGCTGCCCCACTACGGCGGGATGGACGGCGTAGGGGTGCCGGCGTCCATGTACGGGGACC
CGCACGCCCCCCGGCCGATCCCCCCGGTGCACCACCTCAACCATGGGCCGCCGCTACACGCCGGACAGCACTACGGCGC
CCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGACGCTCTGAAGCGGGACAAGGATGCG
ATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACGCCCCGGGAGC
CCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCGCCGTCTTCGCCAAGCAGGTCCGCGC
TGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGCAATACAAGTACTAAGGTTCCACCTC
CTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATTAGTTGTTTGAAAGGGAAAATGCCAA
TAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCTCAGGATCTTCCACAAATTTAGC
CGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGCAGGCACACCGGGGCCCTCCAGT
GGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGACAACAGTGTAGCCTCACCTGGTA
CTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATAT
CATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAAGAAACAGTTAGCCCAAGACACA
GGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCTATGATTGACCAGTCAA
ATCGAGCAGGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTT
TGTATTGGATGGTCAGCAGCACATGGGAATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATGTAACCTTCATCTTGTAAATCAGTCGCAAA
CitationBobak N, Agoston Z, Schulte D. Evidence against involvement of Bmp receptor 1b signaling in fate specification of the chick mesencephalic alar plate at HH16. Neurosci Lett. 2009 Sep 25;461(3):223-8. Epub 2009 Jun 16
CopyrightReprinted with permission from Elsevier. Copyright © 2009 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204803.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 16
Mesencephalon
Midbrain
 
19-22
stage 22
stage 22
Midbrain
 

Entry 6

GEISHA IdMEIS2.Huber.2012Data SourcePublication
Complete cDNA Template Probeshow
ATGGCGCAAAGGTACGATGAGCTGCCCCACTACGGCGGGATGGACGGCGTAGGGGTGCCGGCGTCCATGTACGGGGACC
CGCACGCCCCCCGGCCGATCCCCCCGGTGCACCACCTCAACCATGGGCCGCCGCTACACGCCGGACAGCACTACGGCGC
CCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGACGCTCTGAAGCGGGACAAGGATGCG
ATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACGCCCCGGGAGC
CCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCGCCGTCTTCGCCAAGCAGGTCCGCGC
TGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGCAATACAAGTACTAAGGTTCCACCTC
CTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATTAGTTGTTTGAAAGGGAAAATGCCAA
TAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCTCAGGATCTTCCACAAATTTAGC
CGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGCAGGCACACCGGGGCCCTCCAGT
GGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGACAACAGTGTAGCCTCACCTGGTA
CTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATAT
CATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAAGAAACAGTTAGCCCAAGACACA
GGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCTATGATTGACCAGTCAA
ATCGAGCAGGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTT
TGTATTGGATGGTCAGCAGCACATGGGAATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATGTAACCTTCATCTTGTAAATCAGTCGCAAA
CitationHuber L, Ferdin M, Holzmann J, Stubbusch J, Rohrer H. HoxB8 in noradrenergic specification and differentiation of the autonomic nervous system. Dev Biol. 2012 Mar 1;363(1):219-33. Epub 2011 Dec 24.
CopyrightCopyright © 2011 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_204803.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-29
stage 27
stage 27
stage 27
stage 29
Unlabeled
 

Entry 7

GEISHA IdMEIS2.Ferran.2007Data SourcePublication
Complete cDNA Template Probeshow
TACACGCCGGACAGCACTACGGCGCCCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGA
CGCTCTGAAGCGGGACAAGGATGCGATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAG
CTGGCGACCTGCACGCCCCGGGAGCCCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCG
CCGTCTTCGCCAAGCAGGTCCGCGCTGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGC
AATACAAGTACTAAGGTTCCACCTCCTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATT
AGTTGTTTGAAAGGGAAAATGCCAATAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAAC
TCTCAGGATCTTCCACAAATTTAGCCGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTC
GGCAGGCACACCGGGGCCCTCCAGTGGGGGCCATGCTTCCCA
CitationFerran JL, Sánchez-Arrones L, Sandoval JE, Puelles L. A model of early molecular regionalization in the chicken embryonic pretectum. J Comp Neurol. 2007 Dec 1;505(4):379-403.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
CommentsThe sequence below was obtained from NCBI (acc #: AF199011 - Showing 598 bp region from base 124 to 728) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
stage 18
Mesencephalon
Midbrain
 
19-24
stage 23
stage 23
Mesencephalon
 
25
stage 25
Mesencephalon
 

Entry 8

GEISHA IdMEIS2.Mercader.2000Data SourcePublication
Complete cDNA Template Probeshow
TGTTTGAAAGGGAAAATGCCAATAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCT
CAGGATCTTCCACAAATTTAGCCGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGC
AGGCACACCGGGGCCCTCCAGTGGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGAC
AACAGTGTAGCCTCACCTGGTACTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTT
TCCCCAAAGTAGCAACAAATATCATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAA
GAAACAGTTAGCCCAAGACACAGGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGA
CitationMercader N, Leonardo E, Piedra ME, Martínez-A C, Ros MA, Torres M. Opposing RA and FGF signals control proximodistal vertebrate limb development through regulation of Meis genes. Development. 2000 Sep;127(18):3961-70.
Copyright© The Company of Biologists Limited 2000
CommentsThe sequence below was obtained from NCBI (acc # NM_204803.1 - Showing 468 bp region from base 532 to 999) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 19
stage 19
stage 19
stage 19
stage 19
stage 19
stage 20
stage 20
stage 20
stage 20
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
Blood Vessels
Leg
Limb Buds
Notochord
Wing
control embryo
control embryo
control wing
left side = control side
left wing = control side
right side = -AER
right side = -AER +RAA
right side = FGF1 bead
right side = FGF8 +RA bead
right side = FGF8 +RAA bead
right side = FGF8 bead

Entry 9

GEISHA IdMEIS2.Heine.2008Data SourcePublication
Complete cDNA Template Probeshow
ATGGCGCAAAGGTACGATGAGCTGCCCCACTACGGCGGGATGGACGGCGTAGGGGTGCCGGCGTCCATGTACGGGGACC
CGCACGCCCCCCGGCCGATCCCCCCGGTGCACCACCTCAACCATGGGCCGCCGCTACACGCCGGACAGCACTACGGCGC
CCACGCCCCGCACCCCAACGTCATGCCGGCCAGCATGGGCTCCGCTGTCAACGACGCTCTGAAGCGGGACAAGGATGCG
ATCTACGGGCACCCGCTGTTTCCCCTCCTCGCCCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACGCCCCGGGAGC
CCGGCGTGGCCGGCGGGGACGTCTGCTCCTTCGACTCCTTCAACGAGGACATCGCCGTCTTCGCCAAGCAGGTCCGCGC
TGAAAAACCACTTTTTTCTTCAAACCCAGAGTTGGACAATTTGATGATCCAAGCAATACAAGTACTAAGGTTCCACCTC
CTGGAGTTAGAGAAGGTTCACGAATTGTGCGATAACTTCTGCCATCGGTACATTAGTTGTTTGAAAGGGAAAATGCCAA
TAGACCTCGTGATCGATGAAAGGGATGGCAGCTCCAAGTCAGACCACGAGGAACTCTCAGGATCTTCCACAAATTTAGC
CGACCATAATCCTTCATCTTGGAGAGACCACGATGATGCAACCTCAACGCACTCGGCAGGCACACCGGGGCCCTCCAGT
GGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGCGAGCAAGGGGATGGTTTAGACAACAGTGTAGCCTCACCTGGTA
CTGGGGATGATGATGACCCAGACAAGGACAAAAAGCGACAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATAT
CATGAGAGCATGGCTTTTCCAGCATCTCACACATCCATATCCTTCAGAGGAGCAGAAGAAACAGTTAGCCCAAGACACA
GGACTTACAATTCTACAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCTATGATTGACCAGTCAA
ATCGAGCAGGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTT
TGTATTGGATGGTCAGCAGCACATGGGAATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT
GGGCAATGGCACTACATGTAACCTTCATCTTGTAAATCAGTCGCAAA
CitationHeine P, Dohle E, Bumsted-O'Brien K, Engelkamp D, Schulte D. Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development. Development. 2008 Mar;135(5):805-11. doi: 10.1242/dev.012088. Epub 2008 Jan 23.
CopyrightCopyright held by the authors. Published by the Company of Biologists Ltd.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25
stage 25
Extraembryonic Mesoderm
Eye
Retina
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4046

Mouse

EmageMGI:108564
EurexpressMGI:108564
MGI GXDMGI:108564

Frog

Xenbase487674

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020122-2, ZDB-GENE-000210-23
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona