GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MSX1
msh homeobox 1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolMSX1
Official Full Namemsh homeobox 1
CGNC ID11159
also known asCHOX-7, GHOX-7, HOX-7, homeobox protein MSX-1|Hbox 7|homeobox protein GHOX-7|homeobox protein Hox-7|msh homeo box homolog 1|msh homeobox 1-like protein|msh homeobox homolog 1, Homeobox protein GHOX-7, Hox-7, CHOX-7 , Msx1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205488
PolypeptideNP_990819
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1905
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4487ENSG00000163132MIM:608874MIM:142983
Mouse17701ENSMUSG00000048450All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:97168
Xenopus394692, 100125666, 399464490377
Zebrafish30527ENSDARG00000007641ZDB-GENE-980526-312ZFIN:ZDB-GENE-980526-312
Gene Ontology
Molecular Functionp53 binding, more...RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription, sequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processactivation of meiosis, anterior/posterior pattern specification, apoptotic nuclear changes, more...BMP signaling pathway, BMP signaling pathway involved in heart development, bone morphogenesis, cartilage morphogenesis, embryonic forelimb morphogenesis, embryonic hindlimb morphogenesis, embryonic nail plate morphogenesis, epithelial to mesenchymal transition involved in endocardial cushion formation, face morphogenesis, forebrain development, in utero embryonic development, mammary gland epithelium development, mesenchymal cell proliferation, midbrain development, middle ear morphogenesis, multicellular organismal development, muscle organ development, negative regulation of apoptotic process, negative regulation of cell growth, negative regulation of cell proliferation, negative regulation of striated muscle cell differentiation, negative regulation of transcription from RNA polymerase II promoter, negative regulation of transcription regulatory region DNA binding, odontogenesis of dentin-containing tooth, palate development, positive regulation of BMP signaling pathway, positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator, positive regulation of mesenchymal cell apoptotic process, protein localization to nucleus, protein stabilization, regulation of odontogenesis, signal transduction involved in regulation of gene expression
Cellular Componentnucleus, transcription factor complex
Links to other databases
Entrez Gene396484
Ensembl GeneENSGALG00000015013
KEGGgga:396484

Entry 1

GEISHA IdMsx1.Kamimura.2004Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACACGGGGCCGCCCTGCA
TGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGCC
CGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCTG
CCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCCC
CTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACTT
CCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAGC
CCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCACA
AGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGTA
CCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAAC
CGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCTG
CTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCCA
GCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGGC
CGAGCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTGCC
TGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCAGCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAGCC
CAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGTGG
CCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTATC
ATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationKamimura, M, Matsumoto, K, Koshiba-Takeuchi, K, Ogura, T. Vertebrate Crossveinless 2 Is Secreted and Acts as an Extracellular Modulator of the BMP Signalling Cascade. Dev Dyn. 2004 Jul;230(3):434-45.
CopyrightWiley-Liss, Inc. 2004
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
Endocardium
 

Entry 2

GEISHA IdMsx1.Wu.2006Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACACGGGGCCGCCCTGCA
TGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGCC
CGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCTG
CCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCCC
CTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACTT
CCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAGC
CCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCACA
AGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGTA
CCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAAC
CGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCTG
CTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCCA
GCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGGC
CGAGCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTGCC
TGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCAGCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAGCC
CAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGTGG
CCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTATC
ATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationWu P, Jiang TX, Shen JY, Widelitz RB, Chuong CM. Morphoregulation of avian beaks: comparative mapping of growth zone activities and morphological evolution. Dev Dyn. 2006 May;235(5):1400-12.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
stage 27
stage 28
stage 29
Nasal Placcode/Nerve
Beak
Frontal Nasal Mass,
Frontal Nasal Mass, Beak
31
stage 31
Nasal Placcode/Nerve
Beak
Frontal Nasal Mass,

Entry 3

GEISHA IdMSX1.Shigetani.2000Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACACGGGGCCGCCCTGCA
TGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGCC
CGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCTG
CCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCCC
CTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACTT
CCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAGC
CCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCACA
AGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGTA
CCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAAC
CGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCTG
CTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCCA
GCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGGC
CGAGCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTGCC
TGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCAGCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAGCC
CAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGTGG
CCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTATC
ATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationShigetani Y, Nobusada Y, Kuratani S. (2000). Ectodermally derived FGF8 defines the maxillomandibular region in the early chick embryo: epithelial-mesenchymal interactions in the specification of the craniofacial ectomesenchyme. Dev Biol. 2000 Dec 1;228(1):73-85.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
Pharyngeal Arches and Clefts
Double Labeled
Mandibular Mesenchyme
Maxillary Mesenchyme
19-24
stage 19
stage 20
stage 24
Pharyngeal Arches and Clefts
Double Labeled
Figure 3 compares expression patterns of mesenchymally expressed homeobox genes (Msx1, Fgf8, Dlx1, and Barx1) in chick embryo at HH stages 13, 15, 17, 19, 20, 23 and 24.
Mandibular Arch
Premandibular-Maxillary Transitional Area

Entry 4

GEISHA IdMsx1.Holleville.2007Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACACGGGGCCGCCCTGCA
TGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGCC
CGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCTG
CCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCCC
CTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACTT
CCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAGC
CCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCACA
AGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGTA
CCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAAC
CGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCTG
CTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCCA
GCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGGC
CGAGCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTGCC
TGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCAGCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAGCC
CAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGTGG
CCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTATC
ATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationHolleville N, Matéos S, Bontoux M, Bollerot K, Monsoro-Burq AH. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Dev Biol. 2007 Apr 15;304(2):860-74.
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsAuthors indicated the probe was described in Monsoro-Burq et al, 1995, who said: Chick Msxl cDNA, a gift of Dr Susuki, was digested by Pstl to generate a fragment specific for Msxl, located 3’ to the homeobox. As information provided is insufficient to verify exact sequence used to synthesize the probe, the sequence below was obtained from NCBI (Acc# NM_205488.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-38
stage 38
stage 38
Face Mesenchyme
Osteoblasts

Entry 5

GEISHA IdMSX1.Streit.2002Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACACGGGGCCGCCCTGCA
TGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGCC
CGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCTG
CCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCCC
CTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACTT
CCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAGC
CCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCACA
AGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGTA
CCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAAC
CGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCTG
CTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCCA
GCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGGC
CGAGCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTGCC
TGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCAGCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAGCC
CAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGTGG
CCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTATC
ATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationStreit, A. Extensive cell movements accompany formation of the otic placode. 2002 DEVELOPMENTAL BIOLOGY 249(2), 237-54.
Copyright"Reprinted from Developmental Biology, 249(2), Streit A., Extensive cell movements accompany formation of the otic placode, 237-54, Copyright (2002), with permission from Elsevier". Copyright © (2002) Elsevier B.V. All rights reserved.
CommentsAccording to the authors, "cDNAs for msx1 were kind gifts(see text. As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence was obtained from NCBI (acc# NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 6
stage 6
stage 6
stage 6
stage 6
stage 6
stage 6
stage 6
stage 6
stage 6
Early Embryo
Lateral Plate Mesoderm
Neural Crest
Surface Ectoderm
double label
7-12
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
stage 8
Ectoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Somatic Mesoderm
Splanchnic Mesoderm
Surface Ectoderm
double label
31-44
stage 44
stage 44
stage 44
  

Entry 6

GEISHA IdMSX1.Allen.2001Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationAllen SP, Bogardi JP, Barlow AJ, Mir SA, Qayyum SR, Verbeek FJ, Anderson RH, Francis-West PH, Brown NA, Richardson MK (2001). Misexpression of noggin leads to septal defects in the outflow tract of the chick heart. Dev Biol. 2001 Jul 1;235(1):98-109.
CopyrightCopyright © 2001 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
Heart
Outflow Tract
Atrioventricular Canal
25
stage 25
Heart
Outflow Tract
Atrioventricular Canal

Entry 7

GEISHA IdMSX1.Streit.1999Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationStreit A, Stern CD. Establishment and maintenance of the border of the neural plate in the chick: involvement of FGF and BMP activity. Mech Dev. 1999 Apr;82(1-2):51-66.
CopyrightCopyright © 1999 Elsevier Science Ireland Ltd. All rights reserved
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
 
4-6
stage 4
stage 5
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
 
7-8
stage 8
Lateral Plate Mesoderm
Neural Plate/Tube
 

Entry 8

GEISHA IdMSX1.Stevens.2003Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationStevens CB, Davies AL, Battista S, Lewis JH, Fekete DM. Forced activation of Wnt signaling alters morphogenesis and sensory organ identity in the chicken inner ear. Dev Biol. 2003 Sep 1;261(1):149-64.
CopyrightCopyright © 2003 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 27
Ear/Otic Placcode
Cochlear Duct
31
stage 31
Ear/Otic Placcode
Lateral Crista

Entry 9

GEISHA IdMSX1.Holleville.2003Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationHolleville N, Quilhac A, Bontoux M, Monsoro-Burq AH. BMP signals regulate Dlx5 during early avian skull development. Dev Biol. 2003 May 1;257(1):177-89.
CopyrightCopyright © 2003 Elsevier Science (USA) All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-38
stage 38
stage 38
Head Mesenchyme
Bony Plate

Entry 10

GEISHA IdMSX1.Taneyhill.2005Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationTaneyhill LA, Bronner-Fraser M. Dynamic alterations in gene expression after Wnt-mediated induction of avian neural crest. Mol Biol Cell. 2005 Nov;16(11):5283-93. Epub 2005 Aug 31.
CopyrightCopyright 2004, MBC Online by The American Society for Cell Biology.
CommentsInsufficient information provided in publication to verify exact sequence to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
stage 16
stage 16
Neural Plate/Tube
 

Entry 11

GEISHA IdMSX1.McLarren.2003Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationMcLarren KW, Litsiou A, Streit A. DLX5 positions the neural crest and preplacode region at the border of the neural plate. Dev Biol. 2003 Jul 1;259(1):34-47.
CopyrightCopyright © 2003 Elsevier Science (USA). All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7
stage 7
stage 7
Neural Plate/Tube
Neural Folds

Entry 12

GEISHA IdMSX1.Riley.2003Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationRiley BB, Phillips BT. Ringing in the new ear: resolution of cell interactions in otic development. Dev Biol. 2003 Sep 15;261(2):289-312. Review.
CopyrightCopyright © 2003 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Early Embryo
Lateral Plate Mesoderm
Medial Preplacodal Domain

Entry 13

GEISHA IdMSX1.Khudyakov.2009Data SourcePublication
Complete cDNA Template Probeshow
AGAAGCGGAGCGGAGCCCTGATGCAGAGCCCCGCTTCTCGCCGCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCC
TGCGCAAGCACAAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCG
CAGAAGCAGTACCTGTCCATCGCCGAGCGCGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCT
GGTTCCAGAACCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCAT
GCTCCCGCCTGCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCC
AGCCCCTTCCAGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACC
TTACATAGGGCCGAGCCGCCCGTGCGGACCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGAT
CTGTTCTGTGCCTGGCAGGAAGGAACC
CitationKhudyakov J, Bronner-Fraser M. Comprehensive spatiotemporal analysis of early chick neural crest network genes. Dev Dyn. 2009 Mar;238(3):716-23.
CopyrightPublished Online: 22 Feb 2009 Copyright © 2009 Wiley-Liss, Inc.
CommentsThe sequence below was obtained from BBSRC ChEST Database (ChEST900p21) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 4
stage 5
stage 6
Ectoderm
Epiblast
Mesoderm
Neural Plate/Tube
Placcode
ectomesoderm
neural plate border
posterior epiblast
preplacodal region
7-10
stage 7
stage 7
stage 8
stage 9
stage 10
stage 10
Ectoderm
Mesoderm
Neural Crest
Neural Plate/Tube
ectomesoderm
neural plate border

Entry 14

GEISHA IdMSX1.Basch.2006Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationBasch ML, Bronner-Fraser M, García-Castro MI. Specification of the neural crest occurs during gastrulation and requires Pax7. Nature. 2006 May 11;441(7090):218-22.
CopyrightCopyright © 2006, Nature Publishing Group
CommentsInsufficient information provided in publication to verify exact sequence to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
Area Opaca
 

Entry 15

GEISHA IdMSX1.Fuchs.2010Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationFuchs A, Inthal A, Herrmann D, Cheng S, Nakatomi M, Peters H, Neubüser A. Regulation of Tbx22 during facial and palatal development. Dev Dyn. 2010 Nov;239(11):2860-74.
Copyright© 2010 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
stage 19
stage 23
Face Mesenchyme
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
 
25-27
stage 26
stage 27
stage 27
Face Mesenchyme
Nasal Placode/Nerve
nasal region

Entry 16

GEISHA IdMSX1.Gibson.2011Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationGibson A, Robinson N, Streit A, Sheng G, Stern CD. Regulation of programmed cell death during neural induction in the chick embryo.Int J Dev Biol. 2011;55(1):33-43.
Copyright"Reprinted from Int. J. Dev. Biol., 55(1), Copyright (2011), with permission from the authors and IJDB, Copyright © 2002 UBC Press". All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-8
stage 8
stage 8
stage 8
Early Mesoderm
Epiblast
Extraembryonic Mesoderm
 

Entry 17

GEISHA IdMSX1.Ha.2008Data SourcePublication
Complete cDNA Template Probeshow
TGCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTC
CAGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGG
GCCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGT
GCCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCA
GCCCAGTAGGACATT
CitationHa Y, Tsukada A, Saito N, Zadworny D, Shimada K. Identification of differentially expressed genes involved in the regression and development of the chicken Müllerian duct. Int J Dev Biol. 2008;52(8):1135-41.
CopyrightReprinted from Int. J. Dev. Biol., 55(1), Copyright (2011), with permission from the authors and IJDB
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-35
stage 35
stage 35
stage 35
stage 35
Intermediate Mesoderm
Unlabeled
male, mullerian duct

Entry 18

GEISHA IdMSX1.Stuhlmiller.2012Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationStuhlmiller TJ, García-Castro MI. FGF/MAPK signaling is required in the gastrula epiblast for avian neural crest induction. Development. 2012 Jan;139(2):289-300.
Copyright© 2012. Published by The Company of Biologists Ltd
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-5
stage 5
stage 5
Early Mesoderm
Epiblast
control embryo

Entry 19

GEISHA IdMSX1/2.Ohyama.2008Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationOhyama K, Das R, Placzek M. Temporal progression of hypothalamic patterning by a dual action of BMP. Development. 2008 Oct;135(20):3325-31. Epub 2008 Sep 11.
Copyrightrequested from MP
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # NM_205488.2)= MSX1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
Unlabeled
 
13-18
stage 14
stage 16
Diencephalon
 
25
stage 25
Diencephalon
 

Entry 20

GEISHA IdMSX1.Fisher.2008Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationFisher ME, Clelland AK, Bain A, Baldock RA, Murphy P, Downie H, Tickle C, Davidson DR, Buckland RA. Integrating technologies for comparing 3D gene expression domains in the developing chick limb. Dev Biol. 2008 May 1;317(1):13-23. Epub 2008 Feb 7.
CopyrightCopyright © 2008 Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205488.2 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
stage 22
stage 22
stage 22
stage 22
Central Nervous System
Limb Buds
Pharyngeal Arches and Clefts
 

Entry 21

GEISHA IdMSX1.Marcucio.2005Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationMarcucio RS, Cordero DR, Hu D, Helms JA. Molecular interactions coordinating the development of the forebrain and face. Dev Biol. 2005 Aug 1;284(1):48-61.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_205488.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
Forebrain
Pharyngeal Arches and Clefts
cell adjacent to the ectoderm
maxillary process mesenchyme
all
 
  

Entry 22

GEISHA IdMsx‐1.Afrakhte.2004Data SourcePublication
Complete cDNA Template Probeshow
GCAGAGGCGCACGGCACTCCCCGGGCGGCCCCGGCCCCGCTCCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCA
AAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCGGCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAG
CTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAACCCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAAC
GCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCTGCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCG
GGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCGGAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGC
CGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAGCCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCC
CGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGC
GAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAGGTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAA
GAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAGCGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTC
CCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAACATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGC
CCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTACCACTTATCTTAAGGAGATCAGAAAGGCACAGTGACAGC
GAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATGCAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCT
TCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAAAGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCT
GAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTTTAAAAAAAAAAAAAA
CitationAfrakhte M, Schultheiss TM. Construction and analysis of a subtracted library and microarray of cDNAs expressed specifically in chicken heart progenitor cells. Dev Dyn. 2004 Jun;230(2):290-8.
CopyrightCopyright © 2004 Wiley‐Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Afrakhte et al. 2004.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Early Mesoderm
Extraembryonic Mesoderm
Lateral Plate Mesoderm
 
31-44
stage 44
  

Entry 23

GEISHA IdMsx‐1.Barlow.1999Data SourcePublication
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationBarlow AJ, Bogardi JP, Ladher R, Francis-West PH. Expression of chick Barx-1 and its differential regulation by FGF-8 and BMP signaling in the maxillary primordia. Dev Dyn. 1999 Apr;214(4):291-302.
CopyrightCopyright © 1999 Wiley‐Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 24
Mesoderm
 
25-30
stage 28
Mesoderm
 
31-44
stage 44
  

Entry 24

GEISHA IdMXS-1.Liem.1995Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GGCTCCCGCGCCTCCGCCGCGCCCTCATGAGCCGCGGCCGCCGCTCCCGCGGAGCACGGCGACAGCGGGGCCGCCCTGC
ATGGCCCCGGCTGCGGACATGACCACCGCGCCCACCGGCGTCCGCAGCGACGAGCCGCCCGCCTCCGCCTTCAGCAAGC
CCGGCGGCGGCCTCCCCGTCGCGGCGGCGATGGGCGGCGAGGAGGAGAGCGACAAACCCAAGGTGTCCCCTTCCCCGCT
GCCCTTCAGCGTGGAAGCGCTCATGGCCGACCGCAGGAAGCCGCCGGGCGGCAGAGACGGTCCCGAGGGTTCCGGGCCC
CCTCTGGGCTCCGCCCGAGCCAACCTCGGCGCTCTGACGACGGAGGCACCGACGTCGCCGCTGCCTCTCGGCGGCCACT
TCCCGTCCGTCGGGGCGCTGGGCAAGCTGCCCGAGGACGCGCTGCTCAAAGCAGAGAGCCCCGAGAAGCCGGAGCGGAG
CCCCTGGATGCAGAGCCCCCGCTTCTCGCCGCCCCCGCCCAGGCGGCTGAGCCCCCCCGCCTGCACCCTGCGCAAGCAC
AAGACCAACAGGAAGCCCCGGACGCCCTTCACCACGGCCCAGCTGCTGGCCCTGGAGAGGAAATTCCGCCAGAAGCAGT
ACCTGTCCATCGCTGAGCGTGCCGAGTTCTCCAGCTCGCTCAGCCTCACCGAGACGCAGGTGAAGATCTGGTTCCAGAA
CCGCCGCGCCAAGGCCAAGCGGCTGCAGGAGGCCGAGCTGGAGAAGCTGAAGATGGCAGCCAAGCCCATGCTCCCGCCT
GCTGCATTCGGCATCTCCTTCCCGTTGGGCGGCCCAGCAGTGGCCGGCGCATCCCTGTACGGAGCCTCCAGCCCCTTCC
AGCGAGCGGGGCTGCCCGTGGCCCCTGTGGGACTGTACACGGCGCACGTGGGATATAGTATGTACCACCTTACATAGGG
CCGAGCCGCCCGTGCGGCCCCTGGCAGAGACTTCTCCGCTCCCTTCATCCAGACCTTCAACCCTGGGATCTGTTCTGTG
CCTGGCAGGAAGGAACCCGTGGTGCAGCCCTGCTGGCACCTGGGGAAGGAACTGTGGCAGAGAAAGGGCACAAAGGCAG
CCCAGTAGGACATTTCTGCAAGGCGAGGGTGGGAGGCAGAGCCGCCTGTCCCGTCCCTGCAGGGCAGCTGTTAACCTGT
GGCCATTCCTCCGCCAGCTCCTGAGGAAGGGGCTCTCTCTGTGTACTATGTAATATACTGTATATTTGAAATTTTATTA
TCATTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAAGCTAC
CitationLiem Jr., K.F, Tremml G, Roelink H, Jessell T.M. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell. 1995; 82: 969-979.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205488.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
stage 10
stage 10
Neural Plate/Tube
dorsal region of the neural folds
dorsal region of the neural tube
neural plate rostral to Hensen's node
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1905

Mouse

EmageMGI:97168
EurexpressMGI:97168
MGI GXDMGI:97168

Frog

Xenbase490377

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-312
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona