GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MSX2
msh homeobox 2

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolMSX2
Official Full Namemsh homeobox 2
CGNC ID2130
also known asHOX-8, Msx-2, homeobox protein MSX-2|CHOX-8|GHox-8|homeobox protein Hox-8|homeobox-containing Hox-8|msh homeo box homolog 2|msh homeobox homolog 2, Homeobox protein MSX-2 , GHox-8, CHOX-8
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204559
PolypeptideNP_989890
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4977
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4488ENSG00000120149MIM:604757MIM:123101
Mouse17702All phenotypic alleles (5):Targeted, knock-out(2) Targeted, other(3) MGI:97169
Xenopus394987, 373769852973
Zebrafish30531, 573620ENSDARG00000056697ZDB-GENE-980526-492, ZDB-GENE-980526-322ZFIN:ZDB-GENE-980526-492, ZFIN:ZDB-GENE-980526-322
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity, more...transcription cofactor activity, transcription factor binding, transcription regulatory region DNA binding
Biological Processactivation of meiosis, anagen, anterior/posterior pattern specification, more...BMP signaling pathway involved in heart development, bone trabecula formation, branching involved in mammary gland duct morphogenesis, cellular response to estradiol stimulus, cellular response to growth factor stimulus, chondrocyte development, embryonic forelimb morphogenesis, embryonic hindlimb morphogenesis, embryonic nail plate morphogenesis, enamel mineralization, endochondral bone growth, epithelial to mesenchymal transition involved in endocardial cushion formation, frontal suture morphogenesis, negative regulation of apoptotic process, negative regulation of cell proliferation, negative regulation of CREB transcription factor activity, negative regulation of fat cell differentiation, negative regulation of keratinocyte differentiation, negative regulation of transcription from RNA polymerase II promoter, negative regulation of transcription regulatory region DNA binding, osteoblast development, outflow tract septum morphogenesis, positive regulation of BMP signaling pathway, positive regulation of catagen, positive regulation of mesenchymal cell apoptotic process, positive regulation of osteoblast differentiation, signal transduction involved in regulation of gene expression, transcription, DNA-templated, wound healing, spreading of epidermal cells
Cellular Componentcytoplasm, nucleus, transcription factor complex
Links to other databases
Entrez Gene395245
Ensembl Gene
KEGGgga:395245

Entry 1

GEISHA IdMSX2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCGAGGAGCACCACAAAGTCAAG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGACAGGAGTAGCATAGAGTCCAACGcDNA Template Length688
Forward cDNA Template Probeshow
TCCNGGGAAAATCACGGGCGGGAAGGAAGCACAGGTCTGTGNAAAGGGTAGGATGTTCCGTACAGTGAGGCGGCCTGGA
TGGGGGAGTTGATGGGGAAAGGGAGGCTGAACCCCGACGGCAACATTGGCTTCGCTGCCATTTTGAGCTTCTCTAGCTC
AGCCTCCTGCAGTCTCTTGGCCTTGGCCCTCCGATTTTGGAACCAGATTTTGACCTGGGTCTCTGTGAGGTTGAGGGAG
CTGGAGAATTCGGCTCGCTCGGCGATGGACAGGTACTGCTTCTGGCGGAACTTGCGCTCCAGGGCCAGCAGCTGGGAAG
TAGTGAATGGGGTGCGGGGCTTCCGATTCGTCTTGTGCTTCCTCAGAGTGCAGGCTGTAGGGCTCAGGTGTCTTGGAGG
AGGCGAATATCTCCCGGCCTCTTGGATCCAGGACGTGCCGTCCTCCGAGTTCTCCGATTTGACCGAAGCGGTGTCGAAG
GTTTTTGTAAGAGCCCCGGGGGGGCTGTGCGCGTCCCGGGAGCCGTGGCCCGGCAGCAGCAGGTTCCTGGAGGTGCCCA
CGGTCGCCCCGTCGGCGCTGCCCCCCGCCGCGGCCAGCGGCAGCTCTTTAGGGGGTTTCTTGTCGGACATGAGGGCTTC
CACGCTGAACGGCAAGCTGGACACCTTGACTTTGTGGTGCTCCTCGAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
 
4-6
stage 4
stage 5
stage 6
Germinal Crescent
Lateral Plate Mesoderm
Neural Plate/Tube
 
7-12
stage 7
stage 7
stage 8
stage 9
stage 9
stage 10
stage 11
Anterior Intestinal Portal
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Primitive Streak
Spinal Cord
Dorsal view.
Ventral view.
13-18
stage 13
stage 18
Ear/Otic Placode
Forebrain
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Limb Buds
Nasal Placode/Nerve
Neural Crest
Neural Plate/Tube
Pharyngeal Arches and Clefts
Retina
Somatic Mesoderm
Spinal Cord
Tail
Dorsal view.
19-24
stage 19
stage 23
stage 23
stage 24
stage 24
stage 24
stage 24
stage 24
Forebrain
Hindbrain
Leg
Leg AER
Leg Mesenchyme
Limb Buds
Nasal Placode/Nerve
Oral Pharynx
Pharyngeal Arches and Clefts
Retina
Somatic Mesoderm
Spinal Cord
Valves
Wing
Wing AER
Wing Mesenchyme
 
25
stage 25
stage 25
Forebrain
Hindbrain
Leg
Nasal Placode/Nerve
Oral Pharynx
Retina
Somatic Mesoderm
Spinal Cord
Valves
Wing
 

Entry 2

GEISHA IdMSX2.Fernández-Terán.2006Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationFernández-Terán MA, Hinchliffe JR, Ros MA. Birth and death of cells in limb development: a mapping study. Dev Dyn. 2006 Sep;235(9):2521-37.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204559).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 20
stage 21
stage 21
stage 22
stage 22
stage 23
stage 23
stage 24
stage 24
Leg
Limb Buds
Wing
 
25-30
stage 25
stage 25
stage 26
stage 26
stage 27
stage 27
stage 28
stage 28
stage 29
stage 29
stage 30
stage 30
Leg
Limb Buds
Wing
 
31-32
stage 31
stage 31
stage 32
stage 32
Leg
Limb Buds
Wing
 

Entry 3

GEISHA IdMsx2.Holleville.2007Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationHolleville N, Matéos S, Bontoux M, Bollerot K, Monsoro-Burq AH. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Dev Biol. 2007 Apr 15;304(2):860-74.
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsAuthors indicated the probe was described in Monsoro-Burq et al, 1995, who said: Msx2 specific fragment was taken 3’ to the homeobox as described in Takahashi et al. (1990). As information provided is insufficient to verify exact sequence used to synthesize the probe, the sequence below was obtained from NCBI (Acc# NM_205488.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-38
stage 38
Face Mesenchyme
 

Entry 4

GEISHA IdMSX2.Gamer.2001Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationGamer LW, Cox KA, Small C, Rosen V (2001). Gdf11 is a negative regulator of chondrogenesis and myogenesis in the developing chick limb. Dev Biol. 2001 Jan 15;229(2):407-20.
CopyrightCopyright © 2000 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204559).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
Wing
 

Entry 5

GEISHA IdMSX2.Basch.2006Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationBasch ML, Bronner-Fraser M, García-Castro MI. Specification of the neural crest occurs during gastrulation and requires Pax7. Nature. 2006 May 11;441(7090):218-22.
CopyrightCopyright © 2006, Nature Publishing Group
CommentsInsufficient information provided in publication to verify exact sequence to synthesize probe. Sequence below was obtained from NCBI (NM_204559).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
Neural Crest
double label

Entry 6

GEISHA IdMSX2.Ha.2008Data SourcePublication
Complete cDNA Template Probeshow
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGT
CitationHa Y, Tsukada A, Saito N, Zadworny D, Shimada K. Identification of differentially expressed genes involved in the regression and development of the chicken Müllerian duct. Int J Dev Biol. 2008;52(8):1135-41.
CopyrightReprinted from Int. J. Dev. Biol., 55(1), Copyright (2011), with permission from the authors and IJDB
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204559).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
  
31-35
stage 35
stage 35
stage 35
stage 35
Intermediate Mesoderm
Unlabeled
Male Müllerian duct

Entry 7

GEISHA IdMSX2.Houweling.2002Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationHouweling AC, Somi S, Van Den Hoff MJ, Moorman AF, Christoffels VM. Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken. Anat Rec. 2002 Feb 1;266(2):93-102.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_204559.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 28
stage 28
stage 30
stage 30
Heart
 

Entry 8

GEISHA IdMSX2.Wade.2012Data SourcePublication
Complete cDNA Template Probeshow
CGGCTCCGCAGCGCCTCACTCGCGCAGTCCCCGCGCAGGGCCGGGCAGAGGCGCACGCAGCTCCCCGGGCGGCCCCGCT
CCAGCCACGCTCCGCATTCGCGATGGCTTCTCCTTCCAAAGCGAAGGAGGTTTTCTCCTCCGACGAGGAGGGCCCGGCG
GCCGGCGCCGAGGAGCACCACAAAGTCAAGGTGTCCAGCTTGCCGTTCAGCGTGGAAGCCCTCATGTCCGACAAGAAAC
CCCCTAAAGAGCTGCCGCTGGCCGCGGCGGGGGGCAGCGCCGACGGGGCGACCGTGGGCACCTCCAGGAACCTGCTGCT
GCCGGGCCACGGCTCCCGGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCG
GAGAACTCGGAGGACGGCACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAG
CCTGCACTCTGAGGAAGCACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCG
CAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAG
GTCAAAATCTGGTTCCAAAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAG
CGAAGCCAATGTTGCCGTCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAAC
ATCCTACCCTTTTCACAGACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTAC
CACTTATCTTAAGGAGATCAGAAAGGCACGGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATG
CAGTACCCAACCGGTACTGGCCGTTCTTTCTGCACGCTTCTATCTGCCATCCCGAGTGTACAGGAGTTCGCGTTAGCAA
AGCAAGGCATCCTGTATGCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTT
T
CitationWade C, Brinas I, Welfare M, Wicking C, Farlie PG. Twist2 contributes to termination of limb bud outgrowth and patterning through direct regulation of Grem1. Dev Biol. 2012 Oct 1;370(1):145-53.
CopyrightCopyright © 2012 Elsevier Inc. All rights reserved
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204559.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25
stage 25
stage 25
stage 25
Leg
Left side: control hindlimb

Entry 9

GEISHA IdMSX2.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
GGGACGCGCACAGCCCCCCCGGGGCTCTTACAAAAACCTTCGACACCGCTTCGGTCAAATCGGAGAACTCGGAGGACGG
CACGTCCTGGATCCAAGAGGCCGGGAGATATTCGCCTCCTCCAAGACACCTGAGCCCTACAGCCTGCACTCTGAGGAAG
CACAAGACGAATCGGAAGCCCCGCACCCCATTCACTACTTCCCAGCTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAGC
AGTACCTGTCCATCGCCGAGCGAGCCGAATTCTCCAGCTCCCTCAACCTCACAGAGACCCAGGTCAAAATCTGGTTCCA
AAATCGGAGGGCCAAGGCCAAGAGACTGCAGGAGGCTGAGCTAGAGAAGCTCAAAATGGCAGCGAAGCCAATGTTGCCG
TCGGGGTTCAGCCTCCCTTTCCCCATCAACTCCCCCATCCAGGCCGCCTCACTGTACGGAACATCCTACCCTTTTCACA
GACCTGTGCTTCCTATCCCGCCCGTTGGACTCTATGCTACTCCTGTCGGATATAGCATGTACCACTTATCTTAAGGAGA
TCAGAAAGGCACAGTGACAGCGAGAGAGACTTCCTGGTGGATCTCATCCAGCCTCAAGAATGCAGTACCCAACCGGTAC
TGGCCGTTCTTTCTGCACGCTTCTATCTGCTATCCCGAGTGTACAGGAGTTCGCGTTAGCAAAGCAAGGCATCCTGTAT
GCAACAGGCTGGGTGTCTTCTGAGAGCGCTCTGAGTGCTCACAGTCTGATCCTCAGAGTGTTTAAAAAAAGAAC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST860d14. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XII
Unlabeled
 
1-3
stage 3
Extraembryonic Mesoderm
Primitive Streak
 
4-6
stage 4
stage 5
stage 6
Germinal Crescent
Lateral Plate Mesoderm
Primitive Streak
 
7-12
stage 8
stage 9
stage 10
stage 11
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Amnion
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Myelencephalon
Neural Crest
Neural Plate/Tube
Outflow Tract
Primitive Streak
Ventricles
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 14
Amnion
Anterior/Second Heart Field
Neural Plate/Tube
Outflow Tract
 
19-24
stage 21
stage 24
Allantois
Atria
Cranial Nerve
Ectoderm
Eye
Forebrain
Hindbrain
Leg AER
Leg Mesenchyme
Liver
Lung
Midbrain
Nasal Placode/Nerve
Neural Plate/Tube
Outflow Tract
Pharyngeal Arches and Clefts
Somatic Mesoderm
Valves
Ventricles
Wing AER
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4977

Mouse

EmageMGI:97169
EurexpressMGI:97169
MGI GXDMGI:97169

Frog

Xenbase852973

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-492, ZDB-GENE-980526-322
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona