GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RUNX1T1
RUNX1 translocation partner 1

Gene
Official SymbolRUNX1T1
Official Full NameRUNX1 translocation partner 1
CGNC ID11885
also known asCBFA2T1, MTG8, protein CBFA2T1|MTG8/ETOb|expressed during postmitotic spinal neurons, most likely in motorneurons|runt-related transcription factor 1; translocated to, 1 (cyclin D-related)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204744
PolypeptideNP_990075
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.269
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human862ENSG00000079102MIM:133435
Mouse12395ENSMUSG00000006586All phenotypic alleles (4):Targeted, other(4) MGI:104793
Xenopus100491944, 733153481237
Zebrafish767809ENSDARG00000003680ZDB-GENE-060929-164ZFIN:ZDB-GENE-060929-164
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395503
Ensembl Gene
KEGGgga:395503

Entry 1

GEISHA IdRUNX1T1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5'-ACTAACTTCCCACTGCGACC-3'
Reverse cDNA Template Primer5'-AATTAACCCTCACTAAAGGCCTTGTGCTGGCAAAACGAG-3'cDNA Template Length1111
Complete cDNA Template Probeshow
ACTAACTTCCCACTGCGACCTTTTGTCATCCCATTTTTAAAGGCCAATCTGCCCCTGCTGCAGCGGGAGCTGCTGCACT
GTGCAAGGCTAGCCAAGCAGAACCCAGCCCAGTACCTCGCCCAGCACGAACAGCTGCTTCTGGATGCCAGCACCACCTC
ACCTGTTGACTCCTCAGAGCTGCTTCTCGATGTGAACGAAAACGGGAAGAGGCGAACTCCAGACAGAACCAAAGAAAAT
GGCTTTGACAGAGAGCCTTTGCACTCAGAGCATCCAAGCAAGCGGCCCTGCACTATTAGCCCAGGCCAGCGGTACAGTC
CAAATAATGGCTTATCTTATCAGCCCAATGGTCTGCCTCATCCCACCCCACCTCCACCTCAGCATTATCGTTTGGATGA
TATGGCCATTGCCCACCACTACAGGGACTCATACAGACACCCCAACCACAGGGACCTCAGGGACAGAAACAGACCTATG
GGGTTGCATGGCACACGTCAAGAAGAAATGATTGATCACAGACTAACAGACAGAGAATGGGCAGAAGAGTGGAAACACC
TTGACCATCTGTTAAACTGTATAATGGACATGGTGAAAAAAACTAGGCGATCTCTCACTGTACTTCGGCGATGTCAAGA
AGCAGACCGTGAGGAGCTGAATTACTGGATACGGCGGTACAGTGATGCAGAAGATTTAAAAAAAGGTGGTAACAGCAGC
AGCAGTCATTCCAGACAGCAGAGTCCGGTGAATCCAGATCCAGTTACATTAGAATCGCATCGGGAATTCCTTCACAGGC
CTGCATCTGGATATGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCTGTCAATGAAGTAAAACGTCAGGCAATGGC
AGAGTTGCAGAAGGCAGTGTCAGAAGCCGAGCGGAAAGCTCACGACATGATCACTTCCGAGAGAGCCAAGATGGAGCGC
ACCGTTGCCGAAGCCAAGCGCCAGGCTGCAGAGGATGCACTAGCTGTTATCAATCAGCAGGAGGATTCGAGCGAGAGTT
GCTGGAACTGTGGCCGGAAAGCTAGTGAAACCTGCAGTGGTTGCAACACAGCACGATACTGTGGCTCGTTTTGCCAGCA
CAAGG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Allantois
Blood Vessels
Forebrain
Foregut
Hindbrain
Leg Mesenchyme
Liver
Midbrain
Myotome
Neural Plate/Tube
Outflow Tract
Sclerotome
Sinus Venosus
Ventricles
Widespread Expression
Wing Mesenchyme
 
19
stage 19
stage 19
stage 19
stage 19
stage 19
Allantois
Aorta
Cardinal Veins
Endoderm
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Liver
Lung
Midbrain
Myotome
Neural Plate/Tube
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Sinus Venosus
Ventricles
Widespread Expression
Wing Mesenchyme
 

Entry 2

GEISHA IdRUNX1T1Data SourceGEISHA ISH Analysis
Forward cDNA Template Primer5'-TTCATTCACGCCCACAACG-3'
Reverse cDNA Template Primer5'-AATTAACCCTCACTAAAGGAACCCCATAGGTCTGTTTCTGTCC-3'cDNA Template Length789
Complete cDNA Template Probeshow
TTCATTCACGCCCACAACGTTAACCAATGGCACAAGCCATTCACCAACAGCGTTAAATGGAGCTCCATCTCCTCCTAAT
GGCTTTAGCAATGGGCCATCCTCTTCCTCTTCCTCTTCTCTGGCTAACCAGCAGTTACCACCAGCTTGTGGAGCTAGGC
AGCTCAGCAAACTGAAGAGATTTCTTACAACCTTACAGCAGTTTGGCAATGACATTTCACCAGAGATTGGGGAGAGAGT
GCGTACCCTTGTGCTAGGACTTGTGAATTCTACTTTGACAATTGAAGAATTTCATTCCAAACTGCAAGAAGCTACTAAC
TTCCCACTGCGACCTTTTGTCATCCCATTTTTAAAGGCCAATCTGCCCCTGCTGCAGCGGGAGCTGCTGCACTGTGCAA
GGCTAGCCAAGCAGAACCCAGCCCAGTACCTCGCCCAGCACGAACAGCTGCTTCTGGATGCCAGCACCACCTCACCTGT
TGACTCCTCAGAGCTGCTTCTCGATGTGAACGAAAACGGGAAGAGGCGAACTCCAGACAGAACCAAAGAAAATGGCTTT
GACAGAGAGCCTTTGCACTCAGAGCATCCAAGCAAGCGGCCCTGCACTATTAGCCCAGGCCAGCGGTACAGTCCAAATA
ATGGCTTATCTTATCAGCCCAATGGTCTGCCTCATCCCACCCCACCTCCACCTCAGCATTATCGTTTGGATGATATGGC
CATTGCCCACCACTACAGGGACTCATACAGACACCCCAACCACAGGGACCTCAGGGACAGAAACAGACCTATGGGGTT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Unlabeled
 
7-12
stage 8
stage 10
stage 10
stage 10
stage 11
Heart Tube
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Sinus Venosus
Somites
Ventricles
extraembryonic ectoderm
extraembryonic endoderm
 
19-24
stage 21
stage 21
stage 21
stage 22
Ear/Otic Placode
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Lung
Mesonephros
Midbrain
Pharyngeal Arches and Clefts
Sclerotome
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing Mesenchyme
 
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
Allantois
Ear/Otic Placode
Forebrain
Foregut
Heart
Hindbrain
Leg Mesenchyme
Mesencephalon
Midbrain
Myotome
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing Mesenchyme
 

Entry 3

GEISHA IdMTG8.Koyano-Nakagawa.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGATATCTGTCAAAAGAAACACTTGGAGAGCACTGAGTTTAGTGATAGGTGACTGCCGGAAAAAAGGGAACCTTGAAT
TTTGTCAAGATCGCACTGAGAAGCATTCCACAATGCCAGACTCACCTGTGGATGTGAAGACACAATCTAGGCTGACGCC
TCCAACAATGCCACCTCCTCCAACTACCCAAGGAGCTCCAAGAACGAGCTCATTTACGCCCACAACGTTAACCAATGGC
ACAAGCCATTCACCAACAGCGTTAAATGGAGCTCCATCTCCTCCTAATGGCTTTAGCAATGGGCCATCCTCTTCCTCTT
CCTCTTCTCTGGCTAACCAGCAGTTACCACCAGCTTGTGGAGCTAGGCAGCTCAGCAAACTGAAGAGATTTCTTACAAC
CTTACAGCAGTTTGGCAATGACATTTCACCAGAGATTGGGGAGAGAGTGCGTACCCTTGTGCTAGGACTAGTGAATTCT
ACTTTGACAATTGAAGAATTTCATTCCAAACTGCAAGAAGCTACTAACTTCCCACTGCGACCTTTTGTCATCCCATTTT
TAAAGGCCAATCTGCCCCTGCTGCAGCGGGAGCTCGTGCACTGTGCAAGGCTAGCTAAGCAGAACCCAGCCCAGTACCT
CGCCCAGCACGAACAGCTGCTTCTGGATGCCAGCACCACCTCACCTGTTGACTCCTCAGAGCTGCTTCTCGATGTGAAC
GAAAACGGGAAGAGGCGAACTCCAGACAGAACCAAAGAAAATGGCTTTGACAGAGAGCCTTTGCACTCAGAGCATCCAA
GCAAGCGGCCCTGCACTATTAGCCCAGGCCAGCGGTACAGTCCAAATAATGGCTTATCTTATCAGCCCAATGGTCTGCC
TCATCCCACCCCACCTCCACCTCAGCATTATCGTTTGGATGATATGGCCATTGCCCACCACTACAGGGACTCATACAGA
CACCCCAACCACAGGGACCACAGGGACAGAAACAGACCTATGGGGTTGCATGGCACACGTCAAGAAGAAATGATTGATC
ACAGACTAACAGACAGAGAATGGGCAGAAGAGTGGAAACACCTTGACCATCTGTTAAACTGTATAATGGACATGGTGGA
AAAAACTAGGCGATCTCTCACTGTACTTCGGCGATGTCAAGAAGCAGACCGTGAGGAGCTGAATTACTGGATACGGCGG
TACAGTGATGCAGAAGATTTAAAAAAAGGTGGTAACAGCAGCAGCAGTCATTCCAGACAGCAGAGTCCGGTGAATCCAG
ATCCAGTTACATTAGAATCGCATCGGGAATTCCTTCACAGGCCTGCATCTGGATATGTGCCAGAGGAGATCTGGAAGAA
AGCTGAGGAAGCTGTCAATGAAGTAAAACGTCAGGCAATGGCAGAGTTGCAGAAGGCAGTGTCAGAAGCCGAGCGGCAA
GCTCACGACATGATCACTTCCGAGAGAGCCAAGATGGAGCGCACCGTTGCCGAAGCCAAGCGCCAGGCTGCAGAGGATG
CACTACGTGTTATCAATCAGCAGGAGGATTCGAGCGAGAGTTGCTGGAACTGTGGCCGGAAAGCTACTGAAACCTGCAG
TGGTTGCAACACAGCACGATACTGTGGCTCGTTTTGCCAGCACAAGGACTGGGAGAAGCACCACCACATCTGTGGACAG
ACCCTTCAGGCCCAGCAGCAAGGAGAGACACCAGCAGTGAGCTCCTCAGTGACTCCCAGCAGCGGGGCCGGGAGCCCAT
CGACCACCCCACCAGCAGCCACTCCTAGGTCCACCACCCCAGGAACCCCGTCCACCATAGAGGCGACTCCTCGCTAAAA
CTGAACTCAAAACTCGAAAACAAAAACACAACACAAAATGAAACCAATTCCTCATCCTCAGATGCGCAAAGATTTTAAC
TGAACTGTGCTATTTCAATACTTCAATAAGAAAGAACTTACTGTATCTTGAGGTGGTAGAAAATACAGAAGGCCAGTAA
CGGGTCATAATGACTTATTGTGGATAACAAAGATATCTTTTCGTTAGAAAACTGAAAAGAGAGCAGAGATATAACACAA
AATGATAGGTTTGCCTCCTCCCTGTTATTTTCCAGTAGCTGGGATTTTTAAACTAGATGACCTCATTAACAGAGTGCTT
TACCAAACAGCAAACCAAGAGATTGCTAATTGTCGTTGAAAGCAAAAACGCTAATATTAAAGTCACAACGTTCTTTATA
AA
CitationKoyano-Nakagawa N, Kintner C. The expression and function of MTG/ETO family proteins during neurogenesis. Dev Biol. 2005 Feb 1;278(1):22-34.
CopyrightCopyright © 2004 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204744).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
Spinal Cord
Spinal Ganglia and Nerves
Mantle Zone
Postmitotic Motorneurons
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.269

Mouse

Emage
EurexpressMGI:104793
MGI GXDMGI:104793

Frog

Xenbase481237

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-060929-164
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona