GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NGFR
nerve growth factor receptor

Gene
Official SymbolNGFR
Official Full Namenerve growth factor receptor
CGNC ID9493
also known astumor necrosis factor receptor superfamily member 16|NGF receptor|gp80-LNGFR|low affinity neurotrophin receptor p75NTR|low-affinity nerve growth factor receptor|nerve growth factor receptor (TNFR superfamily, member 16)|p75 ICD, Tumor necrosis factor receptor superfamily member 16 precursor, Low- affinity nerve growth factor receptor, NGF receptor, Gp80-LNGFR, p75 ICD, p75NTR, Low affinity neurotrophin receptor p75NTR
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001146133
PolypeptideNP_001139605
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.39799
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4804ENSG00000064300MIM:162010
Mouse18053ENSMUSG00000000120All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:97323
Xenopus493361, 432338947582
Zebrafish100330017, 564338, 368715ENSDARG00000089223ZDB-GENE-070606-2, ZDB-GENE-050928-1ZFIN:ZDB-GENE-070606-2, ZFIN:ZDB-GENE-050928-1
Gene Ontology
Molecular Function
Biological Processapoptotic process, cell differentiation, nervous system development, signal transduction
Cellular Componentintegral component of membrane
Links to other databases
Entrez Gene425805
Ensembl Gene
KEGGgga:425805

Entry 1

GEISHA Idp75NTR.Okafuji.2005Data SourcePublication
Complete cDNA Template Probeshow
CGGGGGATGCGAGGCGGCCCCGGCGCACCATGGCCGGGTTCGTACCGCTGCTGCTGCTCCTGCTGCCGGCGGGACCCAC
CTGGGGCTCCAAGGAAAAGTGCTTGACCAAGATGTACACGACGAGCGGTGAGTGCTGCAAAGCCTGCAACCTGGGTGAG
GGCGTGGTGCAGCCCTGCGGGGTCAACCAGACCGTCTGCGAGCCCTGCCTGGACAGTGTGACCTACTCGGACACAGTGA
GTGCCACAGAACCGTGCAAGCCCTGCACACAGTGCGTGGGGCTGCACAGCATGTCTGCACCCTGCGTGGAGTCTGACGA
CGCCGTGTGCCGCTGCGCCTACGGCTACTTCCAGGATGAGCTGAGCGGGAGCTGCAAGGAGTGCAGCATCTGTGAGGTG
GGCTTTGGCCTCATGTTCCCCTGCCGGGACTCACAGGACACGGTCTGTGAGGAGTGCCCCGAGGGCACCTTCTCGGATG
AGGCCAATTTCGTGGATCCCTGCCTTCCCTGCACCATCTGCGAAGAGAACGAGGTGATGGTGAAGGAGTGCACGGCCAC
CTCCGATGCTGAGTGCAGAGCGCACCGCGGGCTGCTCGCTCACAGCATCGTGCCTGCAAGCTGA
CitationOkafuji T, Tanaka H. Expression pattern of LINGO-1 in the developing nervous system of the chick embryo. Gene Expr Patterns. 2005 Dec;6(1):57-62. Epub 2005 Jul 18.
CopyrightReprinted with permission from Elsevier. Copyright © 2005 Elsevier B.V. All rights reserved.
CommentsAuthors said: the template for the chick p75NTR probe was a 634-bp (8 bp of 5′-UTR+626 bp of ORF) fragment. The sequence below was obtained from NCBI (acc # XM_423516).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
stage 19
Central Nervous System
Forebrain
Hindbrain
Midbrain
Spinal Cord
Fig. 5 compares several genes.
25-27
stage 27
Spinal Cord
 

Entry 2

GEISHA IdNGFR.Hallböök.1990Data SourcePublication
Complete cDNA Template Probeshow
GCCGAGGCGGCGGGCGGCAGAGGGAGGGCAGCCCGGGGGATGCGAGGCGGCCCCGGCGCACCATGGCCGGGTTCGTACC
GCTGCTGCTGCTCCTGCTGCCGGCGGGACCCACCTGGGGCTCCAAGTGCTTGACTAAGATGTACACGACGAGCGGTGAG
TGCTGCAAAGCCTGCAACCTGGGTGAGGGCGTGGTGCAGCCCTGCGGGGTCAACCAGACCGTCTGCGAGCCCTGCCTGG
ACAGTGTGACCTACTCGGACACAGTGAGTGCCACAGAACCGTGCAAGCCCTGCACACAGTGCGTGGGGCTGCACAGCAT
GTCTGCACCCTGCGTGGAGTCTGACGACGCCGTGTGCCGCTGCGCCTACGGCTACTTCCAGGATGAGCTGAGCGGGAGC
TGCAAGGAGTGCAGCATCTGTGAGGTGGGCTTTGGCCTCATGTTCCCCTGCCGGGACTCACAGGACACGGTCTGTGAGG
AGTGCCCCGAGGGCACCTTCTCGGATGAGGCCAATTTCGTGGATCCCTGCCTTCCCTGCACCATCTGCGAAGAGAACGA
GGTGATGGTGAAGGAGTGCACGGCCACCTCCGATGCTGAGTGCAGAGACCTCCACCCACGCTGGACAACGCACACCCCA
TCCCTGGCGGGTTCTGACAGCCCCGAGCCAATCACCAGGGACCCCTTCAACACCGAGGGGATGGCCACCACCCTGGCAG
ACATTGTCACCACCGTCATGGGCAGCTCGCAGCCCGTCGTGAGCCGCGGCACCGCCGATAACCTCATCCCTGTGTACTG
CTCTATCCTGGCGGCCGTGGTGGTGGGGCTGGTGGCTTACATTGCCTTCAAAAGGTGGAACAGCTGCAAGCAGAACAAG
CAGGGAGCCAACAACCGCCCTGTGAACCAGACGCCTTCCCCAGAGGGGGAGAAGCTGCACAGCGACAGCGGCATCTCGG
TGGACAGCCAGAGCTTGCACGACCAGCAGCCGCCCAACCAGAGCACGCAGGGACCAGCACCAAAGGGAGATGGGAGCTT
GTACGCCAGCCTGCCGCCCAGCAAGCAGGAGGAGGTGGAGAAACTGCTGAGCAGCTCTGCGGAGGAGACGTGGCGGCAG
CTGGCCGGGGAGCTGGGCTACAAGGAGGACCTCATAGACTGCTTCACACGGGAGGAATCGCCCGCCCGAGCGCTGCTGG
CCGACTGGTCGGCCAAGGAGACGGCCACTCTCGACGCCCTCCTGGTGGCCCTGCGGAAGATCCAACGTGGGGACATCGC
TGAGAGCCTGTACAGCGAGTCCACCGCCACCTCACCCGTGTGAAGGGCGGCCCGGAGGGGGGAGGTGCAGCCGGGGGTC
CCCTGCCCGGCTGTCTC
CitationHallböök F, Ayer-Lelièvre C, Ebendal T, Persson H. Expression of nerve growth factor receptor mRNA during early development of the chicken embryo: emphasis on cranial ganglia. Development. 1990 Apr;108(4):693-704.
Copyright© The Company of Biologists Limited 1990
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
stage 18
Ear/Otic Placode
Telencephalon
Visceral arches
25-30
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
stage 26
Cranial Ganglia
Spinal Cord
 
31-44
stage 38
stage 43
stage 44
stage 44
 Hatched P3

Entry 3

GEISHA Idp75NTR.Karlsson.1998Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCCGAGGCGGCGGGCGGCAGAGGGAGGGCAGCCCGGGGGATGCGAGGCGGCCCCGGCGCACCATGGCCGGGTTCGTACC
GCTGCTGCTGCTCCTGCTGCCGGCGGGACCCACCTGGGGCTCCAAGTGCTTGACTAAGATGTACACGACGAGCGGTGAG
TGCTGCAAAGCCTGCAACCTGGGTGAGGGCGTGGTGCAGCCCTGCGGGGTCAACCAGACCGTCTGCGAGCCCTGCCTGG
ACAGTGTGACCTACTCGGACACAGTGAGTGCCACAGAACCGTGCAAGCCCTGCACACAGTGCGTGGGGCTGCACAGCAT
GTCTGCACCCTGCGTGGAGTCTGACGACGCCGTGTGCCGCTGCGCCTACGGCTACTTCCAGGATGAGCTGAGCGGGAGC
TGCAAGGAGTGCAGCATCTGTGAGGTGGGCTTTGGCCTCATGTTCCCCTGCCGGGACTCACAGGACACGGTCTGTGAGG
AGTGCCCCGAGGGCACCTTCTCGGATGAGGCCAATTTCGTGGATCCCTGCCTTCCCTGCACCATCTGCGAAGAGAACGA
GGTGATGGTGAAGGAGTGCACGGCCACCTCCGATGCTGAGTGCAGAGACCTCCACCCACGCTGGACAACGCACACCCCA
TCCCTGGCGGGTTCTGACAGCCCCGAGCCAATCACCAGGGACCCCTTCAACACCGAGGGGATGGCCACCACCCTGGCAG
ACATTGTCACCACCGTCATGGGCAGCTCGCAGCCCGTCGTGAGCCGCGGCACCGCCGATAACCTCATCCCTGTGTACTG
CTCTATCCTGGCGGCCGTGGTGGTGGGGCTGGTGGCTTACATTGCCTTCAAAAGGTGGAACAGCTGCAAGCAGAACAAG
CAGGGAGCCAACAACCGCCCTGTGAACCAGACGCCTTCCCCAGAGGGGGAGAAGCTGCACAGCGACAGCGGCATCTCGG
TGGACAGCCAGAGCTTGCACGACCAGCAGCCGCCCAACCAGAGCACGCAGGGACCAGCACCAAAGGGAGATGGGAGCTT
GTACGCCAGCCTGCCGCCCAGCAAGCAGGAGGAGGTGGAGAAACTGCTGAGCAGCTCTGCGGAGGAGACGTGGCGGCAG
CTGGCCGGGGAGCTGGGCTACAAGGAGGACCTCATAGACTGCTTCACACGGGAGGAATCGCCCGCCCGAGCGCTGCTGG
CCGACTGGTCGGCCAAGGAGACGGCCACTCTCGACGCCCTCCTGGTGGCCCTGCGGAAGATCCAACGTGGGGACATCGC
TGAGAGCCTGTACAGCGAGTCCACCGCCACCTCACCCGTGTGAAGGGCGGCCCGGAGGGGGGAGGTGCAGCCGGGGGTC
CCCTGCCCGGCTGTCTC
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_001146133.1). p75NTR is also known as: NGFR
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-43
stage 35
stage 35
stage 40
stage 43
Retina
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.39799

Mouse

EmageMGI:97323
EurexpressMGI:97323
MGI GXDMGI:97323

Frog

Xenbase947582

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070606-2, ZDB-GENE-050928-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona