GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NKX6-2
NK6 homeobox 2

Gene
Official SymbolNKX6-2
Official Full NameNK6 homeobox 2
CGNC ID7982
also known asNKX-6.2, homeobox protein Nkx-6.2|NK6 transcription factor related, locus 2|locus 2, NKX6.2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001199548
PolypeptideNP_001186477
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2725
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human84504MIM:605955
Mouse14912ENSMUSG00000041309All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:1352738
Xenopus100038084, 779266484526
Zebrafish565782ENSDARG00000044075ZDB-GENE-070626-1ZFIN:ZDB-GENE-070626-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395591
Ensembl GeneENSGALG00000010500
KEGGgga:395591

Entry 1

GEISHA IdNKX6-2.Pedersen.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGTTAGCGGTGGGGCAGATGGATGCTAACCGGCAGAGTGCGTTCGTGCTGGGCAGCACGCCGCTGGCCGCGCTGCACA
ACATGGCCGAGATGAAGAGCTCTCTCTTCCCCTACGCCCTGCAGAACCCCTCCAGCTTCAAGGCGCCGGCCCTGGGCGG
CCTCAACACGCAGTTGCCCCTGGGGACGCCGCACGGCATCAGCGACATCCTGGGGCGGCCCGTGGGCGCCGCCGGCAAC
CTGCTGGGCGGGCTGCCCCGCATCAACGGCCTGGCCGCCTCGGCCGGCGTGTACTTCGGCCCCGCCGCCGTATCCCGGT
ACCCGAAGCCGCTGGCGGAGCTGCCGGGGCGGCCGCCTATCTTCTGGCCGGGAGTGGTACAGGGCTCTCCGTGGCGGGA
CCCGCGCCTCACCTGTCCCGCTCAGACGGGGATGGTTTTGGACAAGGACGGGAAGAAGAAGCACTCGCGCCCGACTTTC
TCGGGGCAGCAGATTTTTGCTTTGGAGAAAACCTTCGAGCAGACGAAGTACCTGGCAGGGCCCGAGCGAGCGCGGCTTG
CCTATTCGCTGGGGATGACAGAGAGCCAGGTGAAGGTGTGGTTCCAGAACAGACGGACCAAATGGCGGAAGCGGCACGC
GGCTGAGATGGCCTCGGCGAAGAAGAAGCACGACTCGGAGACGGAGAAGCTGAAGGAGAGCTCGGACAATGAGGATGAT
GACGAATACAACAAACCCCTGGACCCCAACTCAGATGACGAGAAAATCACGAGGCTATTGAAAAAGCACAAATCCACGA
ACCTCGCCCTCGTCAGCCCCTGCAGCACCAGCTCGGACACGTTGTGAGCGGTGCGCCTGGATGTCGAAGTGGTGTGTTG
TACAGCCCGAGATGTATGTGAAATGTATATATTTTTTACAGAATAAGTTATGAAATTATTTTCTTTCTCATCGATGTAA
ATTTCGGAGGAATCTTTCCGACTTCTTGGTTTTCCTTTCATGTCCCTTTCAGGTTCGCTCCTCTCTCTTTCAGCCAATT
CCTGCTCCTAACAATCAGCGTTTGTCACCGTTTTGTATGGAGCACAAAACCCCAGCGCGGCCACTTTGTACATAGTGAA
CTTCAGATTTTGTGATGTATATTTCTAGTGTAAAAACAGCGTTTTCTTTCACTCCTTCCCTCTGCTCAGGGGTTTGGCG
GTTTGATTTCTTCTGCCTCCGGATTTTATGCTTAATAATATCAAAAGAGGGGAAAAAAAAACGCAAGAGAAAAAAAAGG
ACACTTGATTTTAAATTGGATTAATACTGTCGTCTCCACACGGGTTGGAAAGACTTCGTATACATCAATAAATTATTTA
ACACGCTTTGCCTTCA
CitationPedersen JK, Nelson SB, Jorgensen MC, Henseleit KD, Fujitani Y, Wright CV, Sander M, Serup P; Beta Cell Biology Consortium. Endodermal expression of Nkx6 genes depends differentially on Pdx1. Dev Biol. 2005 Dec 15;288(2):487-501.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_421832).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 11
Endoderm
Neural Plate/Tube
Chicken embryos with antisense probes recognizing Nkx6.1, Nkx6.2, Nkx6.3, Nkx2.2, and Pdx1.
Prospective Pancreatic Endoderm
13-17
stage 15
stage 15
stage 17
Endoderm
Neural Plate/Tube
Pancreas
Chicken embryos with antisense probes recognizing Nkx6.1, Nkx6.2, Nkx6.3, Nkx2.2, and Pdx1.
Pancreatic Buds
Pancreatic Primordia

Entry 2

GEISHA IdNKX6.2.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
TCGGACAATGAGGATGATGACGAATACAACAAACCCCTGGACCCCAACTCAGATGACGAGAAAATCACGAGGCTATTGA
AAAAGCACAAATCCACGAACCTCGCCCTCGTCAGCCCCTGCAGCACCAGCTCGGACACGTTGTGAGCGGTGCGCCTGGA
TGTCGAAGTGGTGTGTTGTACAGCCCGAGATGTATGTGAAATGTATATATTTTTTACAGAATAAGTTATGAAATTATTT
TCTTTCTCATCGATGTAAATTTCGGAGGAATCTTTCCGACTTCTTGGTTTTCCTTTCATGTCCCTTTCAGGTTCGCTCC
TCTCTCTTTCAGCCAATTCCTGCTCCTAACAATCAGCGTTTGTCACCGTTTTGTATGGAGCACAAAACCCCAGCGCGGC
CACTTTGTACATAGTGAACTTCAGATTTTGTGATGTATATTTCTAGTGTAAAAACAGCGTTTTCTTTCACTCCTTCCCT
CTGCTCAGGGGTTTGGCGGTTTGATTTCTTCTGCCTCCGGATTTTATGCTTAATAATATCAAAAGAGGGGAAAAAAAAA
CGCAAGAGAAAAAAAAGGACACTTGATTTTAAATTGGATTAATACTGTCGTCTCCACACGGGTTGGAAAGACTT
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsThe cDNA template used to generate the probe was obtained by PCR as described 5-tcggacaatgaggatgatga-3; 5-aagtctttccaagcccgtgtg-3’
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
Epiblast
 
7-12
stage 7
stage 7
stage 9
stage 11
Hindbrain
Midbrain
Neural Plate/Tube
Spinal Cord
 
13-18
stage 15
stage 18
Hindbrain
Isthmus/MHB
Midbrain
Neural Plate/Tube
Spinal Cord
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2725

Mouse

EmageMGI:1352738
EurexpressMGI:1352738
MGI GXDMGI:1352738

Frog

Xenbase484526

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070626-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona