GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MYCN
MYCN proto-oncogene, bHLH transcription factor

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolMYCN
Official Full NameMYCN proto-oncogene, bHLH transcription factor
CGNC ID12325
also known asN-myc proto-oncogene protein|N-myc protein|v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog|v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001031091
PolypeptideNP_001026262
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.5109
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4613ENSG00000134323MIM:164280MIM:164840
Mouse18109ENSMUSG00000037169All phenotypic alleles (12):Targeted, knock-out(7) Targeted, other(5) MGI:97357
Xenopus448649, 380041, 100337516478858
Zebrafish252851ZDB-GENE-020711-1ZFIN:ZDB-GENE-020711-1
Gene Ontology
Molecular FunctionDNA binding, protein dimerization activity, sequence-specific DNA binding transcription factor activity
Biological Process
Cellular Componentnucleus
Links to other databases
Entrez Gene421948
Ensembl GeneENSGALG00000016462
KEGGgga:421948

Entry 1

GEISHA IdMYCN.Khudyakov.2009Data SourcePublication
Complete cDNA Template Probeshow
GTCTTCCCCTTCCCCGTCAACAAGCGGGAGGCGGCGGTGCCAAGCGGCGGCGAGACCCCGCGGGGCGGCCGCCCGCCGC
GTCCCGCGGGGGAGAGCCGGGCCAGCAGCAGCTCCGGGGACGACACGCTCAGCGACTCGGATGATGAAGACGAGGAGGA
AGAGGATGATGAAGAAGAAATAGATGTTGTGACAGTGGAGAAAAGACGCTCCTCCTCCAACAAGGCTGTTACCACCCTC
ACTATTACAGTGCGTCCTAAAAATACCACTTTTCCATCGGTCAGGACACAGCAGAATGAACTGATTTTAAAGCGTTGTG
CGCCAATTCACCAGCAGCATAATTATGCCGCTCCTTCTCCATATATGGAGAGTGAAGATGTGCCACCACAGAAAAAGTT
AAAAGCCGAGGTGCCCCGTCCAGTAAAACCCATGATCCAACCAAAGTCTAAGAGTTCAAGTCCTCGAAACTCTGATTCG
GAGGACAGCGAACGTCGACGTAACCATAATATCTTGGAGCGTCAGAGGCGTAATGATCTGCGGTCCAGTTTCCTCACGT
TAAGGGACCACGTTCCAGAACTTGTTAAACAATGAGGAAAGCTGCAAAAGCTGTGATTTTGAAAAAAGCCACTTGAATA
TGTCCATTCCCTTCAGGCAGAGGAGCAGAAGTTATTGCTAGAAACAGGAGAAATTGCAAGCCAGGCAACAACAGTTGCT
AACAGAACAATAGAGTACAG
CitationKhudyakov J, Bronner-Fraser M. Comprehensive spatiotemporal analysis of early chick neural crest network genes. Dev Dyn. 2009 Mar;238(3):716-23.
CopyrightPublished Online: 22 Feb 2009 Copyright © 2009 Wiley-Liss, Inc.
CommentsThe sequence below was obtained from NCBI (BU334398) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 5
stage 6
Ectoderm
Epiblast
Neural Plate/Tube
neural plate border
7-10
stage 7
stage 7
stage 8
stage 9
stage 10
stage 10
Ectoderm
Heart
Lateral Plate Mesoderm
Mesoderm
Neural Crest
Neural Plate/Tube
Somites
 

Entry 2

GEISHA IdNMYC.Hu.2012Data SourcePublication
Complete cDNA Template Probeshow
ATGCCGGGAATGATCAGCAAGAACCCGGACCTCGAGTTCGATTCCTTACAGCCTTGTTTCTACCCGGACGAAGATGATT
TCTATTTATGCGGGCCGGACTCGGCCCCCCCCGGGGAAGACATCTGGAAGAAGTTCGAGCTGCTGCCCACCCCTCCGCT
GTCCCCCAGCCGGGCCGGGCTGCAGGAGCCACCCCCCGGGGGGGGCTCCATTGCCGTGGGGAGGGGCGGACCTGGGGAG
TGCCGCCCCGTTGATCCCCTGGACTGGGCGTCCGAGTTGCTCCTCCTGCCCCCCGAGGCCGAGCTGTGGGGCAGCACGG
ACGGCGCGGATTTCTTCGAGACGGGCCTCGGGGCGAGCAACAACCTCAACTCCATCATCATCCAGGACTGCATGTGGAG
TGCGTTCTCGGCCCGCGAGAAGCTGGAGCGGGCGGTCAGCGAGAAGCTGCAGAGCAAGCCTCCCGCCGCCGCCCCGCCG
CCTCCGCCCCCGGTTGTACCCACCGCCGCTTGTCGCCGCCGCGAACAGCCCCAGCGCGGTCCCGGCCGCGCGGAGCTGG
GCGGCTCCGTGCCCGAGTGCGTGGACCCGGCCGTGGTCTTCCCCTTCCCCGTCAACAAGCGGGAGGCGGCGGTGCCAAG
CGGCGGCGAGACCCCGCGGGGCGGGCGCCGGCCGGGTCCCGCGGGGGAGAGCCGGGCCAGCAGCAGCTCCGGGGACGAC
ACGCTCAGCGACTCGGATGATGAAGACGAGGAGGAAGAGGATGATGAAGAAGAAATAGATGTTGTGACAGTGGAGAAAA
GACGCTCCTCCTCCAACAAGGCTGTTACCACCCTCACTATTACAGTGCGTCCTAAAAATACCACTTTTCCATCGGTCAG
GACACAGCAGAATGAACTGATTTTAAAGCGTTGTGCGCCAATTCACCAGCAGCATAATTATGCCGCTCCTTCTCCGTAT
ATGGAGAGTGAAGATGTGCCACCACAGAAAAAGTTAAAAGCCGAGGTGCCCCGTCCAGTAAAACCCATGATCCAACCAA
AGTCTAAGAGTTCAAGTCCTCGAAACTCTGATTCGGAGGACAGCGAACGTCGACGTAACCATAATATCTTGGAGCGTCA
GAGGCGTAATGATCTGCGGTCCAGTTTCCTCACGTTAAGGGACCACGTTCCAGAACTTGTTAAAAATGAGAAAGCTGCA
AAAGTTGTGATTTTGAAAAAAGCCACTGAATATGTCCATTCCCTTCAGGCAGAGGAGCAGAAGTTATTGCTAGAAAAGG
AGAAATTGCAAGCCAGGCAACAACAGTTGCTAAAGAAAATAGAGTACAAGCGGACTTGCTAA
CitationHu N, Strobl-Mazzulla P, Sauka-Spengler T, Bronner ME. DNA methyltransferase3A as a molecular switch mediating the neural tube-to-neural crest fate transition. Genes Dev. 2012 November 1; 26(21): 2380–2385.
CopyrightCopyright © 2012 by Cold Spring Harbor Laboratory Press
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001031091
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-9
stage 9
stage 9
Neural Crest
Neural Plate/Tube
 

Entry 3

GEISHA IdMYCN.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
CTCCGGGGACGACACGCTCAGACGACTCGGATGATGAAGACGAGGAGGAAGAGGATGATGAAGAAGAAATAGATGTTGT
GACAGTGGAGAAAAGACGCTCCTCCTCCAACAAGGCTGTTACCACCCTCACTATTACAGTGCGTCCTAAAAATACCACT
TTTCCATCGGTCAGGACACAGCAGAATGAACTGATTTTAAAGCGTTGTGCGCCAATTCACCAGCAGCATAATTATGCCG
CTCCTTCTCCGTATATGGAGAGTGAAGATGTGCCACCACAGAAAAAGTTAAAAGCCGAGGTGCCCCGTCCAGTAAAACC
CATGATCCAACCAAAGTCTAAGAGTTCAAGTCCTCGAAACTCTGATTCGGAGGACAGCGAACGTCGACGTAACCATAAT
ATCTTGGAGCGTCAGAGGCGTAATGATCTGCGGTCCAGTTTCCTCACGTTAAGGGACCACGTTCCAGAACTTGTTAAAA
ATGAGAAAGCTGCAAAAGTTGTGATTTTGAAAAAAGCCACTGAATATGTCCATTCCCTTCAGGCAGAGGAGCAGAAGTT
ATTGCTAGAAAAGGAGAAATTGCAAGCCAGGCAACAACAGTTGCTAAAGAAAATAGAGTACAAGCGGACTTGCTAAACT
TCTTTTTCTCGTATATTATCATATATCTTGTTGGATATAAATATTTATATATTGGGTTGACCAGGACAGTCTTGTGCCA
TTTGGCACATTTTGGGATTCCTTACAAAAAGAATTCGATATCACAGACTTATACAAAACCGGGACTCAAGGGGGGGCCC
GTAACCA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST442N13. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
Dermomyotome
Ear/Otic Placode
Ectoderm
Endoderm
Forebrain
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesencephalon
Midbrain
Myelencephalon
Neural Crest
Neural Plate/Tube
Pharynx
Somatic Mesoderm
Somites
Splanchnic Mesoderm
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.5109

Mouse

EmageMGI:97357
EurexpressMGI:97357
MGI GXDMGI:97357

Frog

Xenbase478858

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020711-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona