GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CNOT1
CCR4-NOT transcription complex subunit 1

Gene
Official SymbolCNOT1
Official Full NameCCR4-NOT transcription complex subunit 1
CGNC ID1639
also known asCCR4-NOT transcription complex subunit 1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001277133
PolypeptideNP_001264062
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.53936
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100858397
Ensembl GeneENSGALG00000002301
KEGGgga:100858397
GEISHA IdNot1.Chapman.2008Data SourceDirect Submission
Complete cDNA Template Probeshow
CGTGAGCGCGCGACCTGTCCGCCATTTTGTAGCGCAACGGCGGAGACGAGAGGAGAAAAGCGCGAGCGGCCGCAGCCCG
GCGCCTTGCTCCGGCCCCGCCGCCTCTGAGGTGCCATGTTTCTGTACAGAGGAAGACAACTGAGAAAGAGCTGAAGAAA
GTAACACAACCAGATACAGGCTAATTGGGGGAAAAACAATTAACCTGTCTCTGAGGTGACTAAAGGGGAATAATGGTGA
TTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAA
TCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAAGAAATACAGCACATTGTGAATAGGCA
CGGTCCCGAGGCAGACAGGCATTTACTACGCTGTCTATTCTCGCACGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGC
AAAGATTTCCATCAGACTCAATTTCTGATCCAGGAGTGTGCGTCGCTGATTACAAAACCAAACTTTATCTCGACGCTGT
CCTACGCCATTGACAATCCATTGCACTATCAGAAGAGTCTAAAGCCTTCACCCCATTTATTTGCCCAATTGAGTAAAGT
CATCAAATTAAGTAAAGTTCAAGAGGTGATATTTGGTCTCGCTTTACTGAACTCTTTCAGCTCAGATCTACGAGGTTTT
GCTGCCCAGTTTATCAAACAGAAACTCCCAGATCTTTTACGCTCTTACATTGACGCGGACGTCAGTGGAAATCAAGAAG
GTGGCTTCCAAGATATTGCAATAGAGGTCCTGCACCTTCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGG
GGTGGGACAGGAACAGATTGACGCTTTCCTCAAAACATTACGTAGAGATTTTCCCCAGGAGCGTTGCCCTGTGGTGCTT
GCACCACTTCTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGATAGCCAAAACAA
TGATGGAGAGTTCTCTGGCAGACTTTATGCAAGAAGTTGGCTATGGCTTTTGTACAAGCATTGAAGAATGTCGCAACAT
AATCATGCAGTTTGGAGTCCGGGAGGTGACGGCTGCCCAGGTTGCCAGGGTTCTGGGGATGATGGCTCGAACGCATTCG
GGGTTGACGGATGGTATTCCATTACAATCTATTTCGGCTCCTGGCAGTGGAATTTGGAGCGATGGGAAAGATAAAAGTG
ATGGAGCACAAGCCCATACCTGGAATGTGGAGGTCCTAATTGATGTTCTTAAAGAGCTGAATCCTAGCCTGGATTTCAA
AGTAGTAACGTATGAATTGGACCACCCAGGATTTCAGATTCGTGACAGCAAAGGCCTGCATATTGTGGTGTTTGGCATC
CAGAGAGGGCTAGGCATGGAAGTTTTTCCAGTTAATGCCATATACAGACCTTGGAAGCATGCAGAGGGCCAGCTCTCCT
TCATTCAACATTCCCTCATAAACCCGGACATCTTTTGTTTTGCTGACTACCCTTGTCATGCTGTTACCACAGACATCCT
GAAAGCACCACCAGAGGATGACAATCGAGAAATTGCTACATGGAAGAGCCTGGATTTGATCGAATCTCTGTTACGGTTG
GCAGAAGTGGGACAGTATGAGCAGGTTAAGCAGCTCTTCAGTTTTCCCATCAAGCATTGCCCAGATATGTTGGTATTGG
CCTTATTGCAGATCAACACTTCCTGGCATACCTTGCGCCATGAACTCATCTCCACGCTCATGCCAATCTTCCTTGGCAA
CCATCCCAATTCTGCCATCATTTTGCACTATGCATGGCATGGGCAGGGTCAGTCTCCTTCGATTCGCCAGCTTATCATG
CATGCAATGGCAGAATGGTACATGAGAGGGGAGCAGTATGACCAGGCAAAATTGTCACGTATTCTTGATGTGGCGCAAG
ACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCGTTTGCCTTTGTTATTGACCTTGCTGCACTTGCCTCTCGACG
AGAATACCTCAAACTTGACAAATGGCTCACAGACAAAATTCGGGAGCATGGGGAGCCCTTCATCCAGGCCTGCATGACC
TTCTTAAAGAGAAGATGTCCATCTATCCTAGGTGGCCTTGCTCCAGAAAAAGATCAACCCAAAAGTGCTCAGCTTCCTC
CAGAAACCTTGGCAACTATGTTGGCATGCCTGCAGGCTTGTGCTGGGAGTGTTTCTCAGGAGCTGTCGGAGACCATCCT
CACCATGGTAGCCAACTGCAGTAATGTCATGAACAAGGCCAGACAGCCACCACCTGGAGTCATGCCCAAAGGCCGCCCG
CCCAGCGCGAGCAGCCTGGATGCCATCTCTCCTGTGCAGATTGACTCGCTTGCAGGAATGGCATCTCTGAGTTTAGGTG
GCTCGGCTGCTCCTCACACCCAGAGCATGCAAGGCTTCCCTCCAAACTTGGGCTCTGCGTTCAGTACTCCTCAGTCACC
AGCAAAAGCGTTTCCCCCTCTTTCCACCCAAAACCAGACAACAGGTTTCAGTGGCATTGGAGGACTCTCTTCACAGCTT
CCAGTAGGTGGTCTTACTACGGGTAGCCTGACTGGCATAGGAACTGGAGCCCTGGGCCTTCCTGCAGTGAACAATGACC
CATTCGTGCAAAGGAAGCTGAGCACATCTGGACTGAGCCAGCCTACGTTCCAGCAGAGTAAGATGAAACCTTCTGACTT
ATCTCAGGTGTGGCCAGAGGCTAATCAGAACTTTAGCAAAGAAATAGATGATGAGGCAAACAGCTACTTCCAGCGTATC
TATAACCATCCACCACATCCAACCATGTCTGTAGATGAGGTCTTGGAAATGCTGCAGAGGTTTAAGGACTCCAATATTA
AACGGGAACGAGAAGTGTTTAACTGTATGCTGAGGAACTTGTTTGAGGAATACCGTTTCTTTCCCCAGTACCCAGACAA
AGAGCTGCACATAACAGCCTGCCTCTTTGGTGGGATAATAGAGAAAGGACTGGTTACTTACATGGCTTTGGGCCTGGCC
CTTCGCTACGTTCTTGAAGCCTTACGAAAGCCTTTTGCGTCCAAAATGTACTATTTTGGTATTGCTGCACTAGATAGAT
TTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATTAGTCACTTTATACAGTTCCCTCATCA
CTTGCAGGAGTACATAGAATACGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGTTCAATCACCACCCCTGGA
AGTATTGCACTTGCCCAGGCTCAGGCCCAGGCCCAGGTTCCAGCAAAGGCTCCTCTTGCTGGCCAAGTCAGCACTATAG
TAACCACCTCAACCACCACCACTGTTGCAAAAACCATCACGATCACTCGACCAACTGGAGTCAGCTTCAAGAAAGATGT
GCCGCCTTCCATTAATACTACCAACATTGATACACTGTTAGTAGCAACGGATCAAACTGAGAGAATTGTGGAACCTCCA
GAGAACGTCCAGGAAAAAATTGCTTTCATCTTCAATAATCTGTCTCAGTCAAACATGACACAGAAGGTTGAAGAACTGA
AGGAAACAGTGAAAGAAGAGTTCATGCCTTGGGTATCGCAGTATCTCGTGATGAAGAGAGTCAGCATTGAGCCAAATTT
TCACAGCTTATATTCAAACTTCCTTGACACCCTTAAGAATCCAGAGTTTAATAAAATGGTTCTGAATGAAACTTACAGA
AATATCAAGGTGCTACTGACATCAGATAAGGCTGCAGCCAACTTCTCCGACCGTTCCTTGTTAAAGAACCTTGGTCACT
GGCTGGGAATGATTACCCTGGCTAAAAATAAACCCATCTTGCACACGGATTTGGATGTGAAGTCACTACTACTGGAAGC
GTATGTGAAGGGACAGCAGGAATTGCTTTATGTAGTACCATTTGTTGCCAAAGTCTTAGAATCCAGTGTCAGGAGTGTG
GTCTTCAGGCCTCCAAACCCATGGACAATGGCCATTATGAATGTTTTAGCTGAGCTGCATCAAGAACATGATCTAAAAG
TAAATTTTCTGCTTTGTTTGTACCTATTGAGCTTGAGGTTTTCTTGACACACCAGTCAGNCTGAACCTGGCAGTCTCCT
GAAAGATAAGGATCGTCTGAAAAATCTGGATGAGCAGCTGTCTGCTCCAAAGAAGGATGTGAAGCAGCCAGAAGAGCTA
CCACCCATCACAACAACCACCGCTTCTACAACTCCAGCTACCAGCACCACTTGTACAGCCACAGTTCCTCCACAGCCCC
AGTACAGTTATCATGACATCAATGTCTATTCATTAGGAGGACTGGCTCCACACATTACCTTAAATCCAACGATCCCGCT
GTTTCAGGCCCACCCCCAGCTGAAGCAGTGTGTGCGGCAGGCTATAGAGCGAGCGGTGCAGGAGCTCGTCCATCCCGTG
GTCGATCGGTCCATTAAGATTGCCATGACTACTTGTGAGCAGATAGTCAGGAAGGACTTTGCACTGGATTCGGAGGAGT
CACGAATGCGTGTGGCTGCACACCATATGATGCGGAACTTGACTGCTGGGATGGCCATGATCACCTGCAGGGAACCTTT
GCTCATGAGCATAGCTACCAACTTGAAGAACAGTTTTGCTACTGCGCTGAGGGCAGCCTCCCCACAACAGAGGGACATG
ATGGAGCAAGCAGCTGCCCAGCTGGCGCAGGATAACTGTGAGCTGGCGTGCTGCTTTATCCAGAAGACAGCTGTGGAAA
AAGCAGGCCCTGAAATGGACAAGAGGCTGGCGACTGAATTTGAGCTCAGAAAACATGCTAGACAAGAGGGTCGTCGGTA
CTGTGATCCTGTTGTGTTAACTTACCAAGCTGAACGGATGCCAGAACAGATCAGGTTAAAGGTTGGAGGTGTGGACCCA
AAACAGCTGGCTGTTTACGAAGAGTTCGCACGTAACGTCCCCGGCTTCTTGCCTACCAATGACTTAACTCAGCCTACAG
GATTCTTGGCTCAACCTATGAAGCAAGCTTGGGCCACAGATGATGTAGCACAAATCTATGACAAATGCATGACAGAACT
GGAGCAGCACCTACAGTCCATTCCCCATACTCTGGCCATGAATCCTCAAGCTCAAGCATTACGCAGCCTCCTGGAGGCT
GTGGTGGTCGCTCGGAACTCCCGTGATGCCATCGCTGCGCTTGGACTGCTGCAGAAGGCTGTAGAGGGCTTACTGGATG
CCACCAGTGGGGCAGATGCTGACCTTCTGCTTCGCTATCGTGAGTGTCACCTGCTGGTGCTGAAGGCTCTGCAGGACGG
CCGTGCGTATGGATCTCCGTGGTGTAACAAGCAGATTACCAGGTGCCTGATTGAGTGTAGAGATGAGTACAAGTACAAC
GTGGAAGCTGTGGAGCTGCTAATCCGCAATCACCTGGTTAACATGCAGCAGTATGATCTTCACCTGGCACAGTCAATGG
AGAACGGCTTGAACTATATGGCTGTGGCATTTGCCATGCAGTTGGTAAAGATCCTTCTTGTGGATGAGAGAAGTGTTGC
CCATGTAACAGAGGCAGATCTGTTCCACACCATCGAGACGCTCATGAGGATTAATGCTCATTCCAGAGGGAATGCCCCA
GAAGGGTTACCCCAGTTGATGGAAGTGGTCCGATCAAACTACGAAGCAATGATTGACCGTGCTCACGGAGGTCCCAATT
TCATGATGCATTCTGGAATTTCCCAAGCCTCTGAGTATGATGATCCACCAGGTCTGAGGGAGAAGGCAGAATACCTGCT
GAGGGAGTGGGTCAACCTCTACCATTCTGCTGCAGCGGGCCGCGACAGTACCAAAGCGTTCTCTGCGTTTGTTGGACAG
ATGCACCAGCAAGGGATCCTGAAAACAGATGACCTGATCACCCGCTTTTTCCGGCTTTGCACTGAAATGTGTGTTGAAA
TCAGCTATCGTGCTCAGGCTGAGCAACAGCACAACCCTGCTGCCAACCCCACGATGATCCGGGCCAAGTGCTACCACAA
TCTGGATGCCTTTGTGCGGCTTATTGCACTGCTTGTGAAGCACTCTGGAGAAGCAACCAACACCGTTACGAAGATCAAC
CTCCTGAACAAGGTTCTTGGTATTGTGGTGGGAGTTCTTCTGCAAGACCATGAAGTTCGGCAGGGTGAGTTTCAGCAGC
TTCCTTACCATCGCATCTTCATCATGTTGCTGTTGGAATTAAATGCTCCTGAGCATGTGTTGGAGACCATCAACTTCCA
GACGCTCACAGCTTTCTGTAACACATTTCACATCCTGAGGCCTACAAAAGCTCCAGGTTTTGTTTATGCCTGGCTGGAA
CTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACACCACAGCAGAAGGGTTGGCCTATGTATGCCCAGT
TACTGATCGATCTTTTCAAGTACTTGGCTCCTTTTCTCAGAAATGTGGAACTCACCAAACCTATGCAAATTCTTTACAA
GGGCACTCTGCGTGTGTTGCTGGTCTTGTTGCATGATTTCCCAGAATTTCTTTGTGACTACCATTATGGGTTCTGCGAT
GTCATCCCACCTAACTGTATTCAGTTAAGGAATTTGATCCTGAGTGCCTTCCCACGGAACATGAGGCTTCCAGACCCTT
TCACCCCCAATCTGAAGGTGGACATGTTGAGTGAAATTAATATTGCTCCACGAATTCTCACCAATTTCACGGGAGTGAT
GCCACCTCAGTTCAAGAAAGACTTGGATTCCTATCTCAAAACCCGATCTCCAGTCACTTTTTTGTCTGACTTGCGCAGC
AACTTACAAGTATCAAATGAACCTGGCAACCGCTACAACATCCAGCTGATTAATGCCCTGGTGCTCTACGTAGGTACTC
AGGCTATTGCGCACATCCACAACAAAGGCAGCACACCCTCCATGAGCACCATTACCCACTCAGCACACATGGACATCTT
CCAGAATTTGGCAGTGGACCTGGACACCGAAGGTCGGTACCTCTTCCTGAATGCAATTGCCAATCAGCTGCGATACCCC
AACAGTCATACCCACTACTTCAGCTGCACCATGCTTTACCTGTTTGCAGAGGCCAACACTGAGGCTATCCAGGAGCAGA
TCACAAGGGTTCTCTTGGAACGACTGATTGTAAATAGGCCTCATCCCTGGGGTCTCCTCATTACTTTCATCGAGCTGAT
AAAAAACCCAGCATTTAAGTTCTGGAACCATGAATTTGTTCACTGCGCTCCAGAAATTGAGAAGTTGTTCCAGTCGGTT
GCACAGTGCTGCATGGGGCAGAAGCAAGCCCAGCAAGTAATGGAGGGGACTGGTGCCAGTTAGATGAGCTGCATCTTGT
GTTGTAAATGTGCCAGCCTGGAGGCCCCTGTCCCATCGACCGACAGAAGCATCTGTAAGGCTCCTCCTGACCTTCCCAG
CTCCCTCGATTGGGTACACGCAACCGACCTGGGGTGAAAGTCTGTGGGCACGTTCCAAAGTTTGAAACAAATTTGTGAC
TTTTGGCCAAAATTCAGAAGATGCTGTGAATATCATTTTGAACTAGTGTAAATACAAGGAACAGAAACGTTTGTCTGGA
CTTCTGGGTTTGTGCAAAGTGTGTAAAAGGCAAGTGGGTAACTGGTGCCTGTCCAGCTTGTAATAAAGGGGCAGCTGCT
GATGCCAAGTGCTTGTCTGGGGCAGACCTCCTTGTCCTGACATTGCCAGACTCCCAAAGAATATTGAAAAGCCAGTTAT
ATTATTATGTAACTTATTTTTTTCTTTATGTGGATGGGGGACCTTTAAATCACTAAGTTGTTTTACAGAAAAAGAAAAG
TGGATATGTTTGGAATATGGGAATACTATGGAGTAAGGGAGGGGAGGGCGAGGGAGGGACTGAAGATTCAGCATTGTTT
TCCCCTTTCCTCCCAGTGCTGACGGAGCCGTGTGGCAGTCAGAACGCCTCCTTTCTGTGGGAGAAGACACGCCTCAGGC
CCTTTGGGAGAGGGTCAGCTGTTTTTAGTAAAGAAACCAGAGACCAGGCCTATAGCTTTT
CommentsImages Provided by Susan Chapman
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Area Pellucida
Hensen's Node
 
4-6
stage 4
stage 5
stage 6
Head Process
Hensen's Node
Notochord
 
7-12
stage 7
stage 7
stage 8
stage 8
stage 9
stage 10
Head Process
Hensen's Node
Notochord
 
13-17
stage 17
Notochord
Pineal Gland
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.53936

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona