GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

OTX2
orthodenticle homeobox 2

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolOTX2
Official Full Nameorthodenticle homeobox 2
CGNC ID14164
also known ashomeobox protein OTX2|orthodenticle homolog 2, homeobox protein OTX2 , Otx2 , orthodenticle homeobox 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204520
PolypeptideNP_989851
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.10
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human5015MIM:613986MIM:600037
Mouse18424ENSMUSG00000021848All phenotypic alleles (32):Targeted, knock-out(11) Targeted, other(21) MGI:97451
Xenopus548931, 432013, 399342485219
Zebrafish30501ENSDARG00000011235ZDB-GENE-980526-406ZFIN:ZDB-GENE-980526-406
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395191
Ensembl Gene
KEGGgga:395191

Entry 1

GEISHA IdOtx2Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CATGGTTTTTTTTTCACACACCAACATTTATTCCAAGACACGTTACAGCTGGGAAGAGGCGCACACGTTTCACTCCTGG
CTCTCAGGCAAAACATCACAGATCAGCCCCTTCCAGGCCCCATAGCAGCCCCTTCCAGGCCCCATAGCAGCCCCTTCCA
GGCCCCATAGCAGCCCCTTCCAGGCCCCCCACAAAGGCTCGGGCACTTCTAACAAGCTTCCAAGCCACCCCCAAACAAG
CATCCTGCCCACAAGGCACCGTTCCCCACACACTGGGACCCACCCTGGGTCAGAAACGCAGCTCCTGCCCTGCCCCACA
GCACCCACAAGCAGAGCGCTGCCATCCAGCTGTGCTCAGAGCTGTTAGGGTCGCTGAATTTGGAGAGGACCCGACCGGC
GGCTATGCCCCCCGCGCCCCCCAGCCGTGCCAGCGGCCCCGCAGGCACCTGGCGGCCCCCCCCTCCGCCCGACGGCACC
CCCAGCACCGCCCGGGGCAGGCAGGGCGCTCGGGCGGACCCCCCTCGCCCGGATTTCGGCCAACTCTCCTCCCCGCTCC
AACTTTAGCATGATGTCTTATCTTACGCAACCACCTTACGCAGTCATTGGCTTGAGTTTCACCACTTCGGGCATGGATT
TGTTGCATCCGTCAGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACCACCTTCACCCGGGCGCAGCT
GGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGGAGGTGGCCTTGAAAATCAAC
CTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCAGCAGCAGCAGCAGCAGAACG
GGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGCTCGGAGAGCGGGACCAGCGG
GCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCGTGTCCATCTGGAGCCCGGCG
TCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAAGTCCTACCCCATGACCTACACCCAGG
CATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGTGGATCTTATTTGACCCCTAT
GCACCACCAGCTCCCCGGACCGGGGGCCACCCTGATTCCCATGGGTGCCAATGCGGTCACCAGCCACCTCAACCATTCT
CCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCATTTTGGGCTTTAACTCAACCACCGATTGCTTGGATTATAAAA
ACCAAACCGCTTCTTGGAATTTAAACTTCAATGCTGACTGCTTGGATTATAAAAACCAAACTTCCTCATGGAAGTTCCA
GGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATTGTGACGAGAACAAAACACGCTGGGCCCGAACGT
TCCAGCTTTAGTCAGGTTTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGACAAACAAATGAACATAAATC
CGACGACGACAACAACGGGGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTCATCTCCTGCTCAGACGCTC
TGGAAAAGGAACGACAAAGAGGAAAACGGAGGAGGAAGGCCTTTAAAACGGACAGAATCATTTAGTGAGGCAGAAAACC
GGACAGACCAATCCGTGTTCTTTAATAGTTTTAGGCAATTTGTTGGGGTTTCTTTTGTTTGGAAGAGGTGGGAGATCGT
TCCCACCTATGGGCCAGTTTTTAAACAAAAAAAAAAAAGTCTAGGTTTTTATTTCTTTTTGTGTGTGCGTGGAAAGATC
CTTCACCCAGAGGTTTCCAACGTCTTAGCCAACCCTTGGTTAAAATATTCGGAATGGACAGCGTCTCTCTTTCTCTTTT
TCTCCCCTTTTTTCTCCCTCCTTCCCTCCCTCTTTCTTTCTCTCTCGCGCTCATCCAACTGTTTGACGCCCAACTCAAG
TGGGCACCGAGAGAACTTGGTTCAGGGCTGTGTGGGTTGTGTGACTGATTGTCCTAGCTGCACTACTTTATTTAAAGAA
AAAAAAAATAATGTTCATAAGGAGTCAATATGTAGTTTTTAAGAGACAATCAGTGTGTGTCTTATATAAATGGTACATC
TGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCCTGTATTGTATGCAACTACGAACTCCGCACCAGCGGGA
GTTCCGCTGTGATTTAAATAGGTTATAATTATAAGTGAAATTCAGAGCAACTGAGTTACCTATTATCATCTTTCTAAAA
A
CommentsImages provided by Susan Chapman
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Forebrain
Midbrain
 
13-17
stage 17
Cranial Ganglia
Forebrain
Midbrain
Pharyngeal Arches and Clefts
 

Entry 2

GEISHA IdOtx2.Chapman.2002Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationChapman SC, Schubert FR, Schoenwolf GC, Lumsden A. Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev Biol. 2002 May 1;245(1):187-99.
Copyright2002 Elsevier Science (USA). All rights reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XIII
stage XIV
Epiblast
Hypoblast
 
1-3
stage 3
Endoderm
Head Process
Hensen's Node
Neural Plate/Tube
Primitive Streak
 
4-5
stage 4
stage 5
Early Endoderm
Ectoderm
Epiblast
Forebrain
Midbrain
Neural Plate/Tube
 

Entry 3

GEISHA IdOTX2.Ohuchi.2007Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationOhuchi H, Hayashibara Y, Matsuda H, Onoi M, Mitsumori M, Tanaka M, Aoki J, Arai H, Noji S. Diversified expression patterns of autotaxin, a gene for phospholipid-generating enzyme during mouse and chicken development. Dev Dyn. 2007 Apr;236(4):1134-43.
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
Diencephalon
Midbrain
 

Entry 4

GEISHA IdOtx2.Abe.2006Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationAbe Y, Chen W, Huang W, Nishino M, Li YP. CNBP regulates forebrain formation at organogenesis stage in chick embryos. Dev Biol. 2006 Jul 1;295(1):116-27. Epub 2006 Apr 19.
CopyrightReprinted from Developmental Biology, 295, Yoko Abea, Wei Chena, Wei Huangc, Mizuho Nishinod and Yi-Ping Li, CNBP regulates forebrain formation at organogenesis stage in chick embryos, 116-127, Copyright 2006, with permission from Elsevier. Copyright © 2006 Elsevier B.V. All rights reserved.
CommentsAs information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_204520)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-21
stage 19
stage 19
stage 21
Forebrain
Midbrain
 

Entry 5

GEISHA IdOtx2.vonFrowein.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CommentsAuthors said "Plasmid templates were used to generate digoxygenin antisense riboprobes: Otx2 (Wassef et al., 1987). However, no Otx2 clone is listed in this paper. As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
stage 22
Forebrain
 
25-28
stage 28
Forebrain
 

Entry 6

GEISHA IdOtx2.Sanchez-Calderon.2007Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationSánchez-Calderón H, Francisco-Morcillo J, Martín-Partido G, Hidalgo-Sánchez M (2007). Fgf19 expression patterns in the developing chick inner ear.Gene Expr Patterns. Jan;7(1-2):30-8. Epub 2006 May 19.
CopyrightCopyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 15
stage 15
Ear/Otic Placcode
Figure 1. includes HH stage 14 and 15. Also, includes comparison of Fgf19 expression to Fgf8, Fgf10 and Otx2 expression in chick embryos.
19-24
stage 20
stage 20
stage 24
stage 24
stage 24
Ear/Otic Placcode
Figure 2 includes comparison of Fgf19 expression to Fgf8, Otx2 and Bmp4 expression in stage 20 chick embryos.
Figure 3. includes comparison of Fgf19 expression to Fgf8, Otx2 and Bmp4 expression in stage 24 chick embryos.

Entry 7

GEISHA IdOtx2..Badde.2005Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationBadde A, Bumsted-O'Brien KM, Schulte D. Chick receptor protein tyrosine phosphatase lambda/psi (cRPTPlambda/cRPTPpsi) is dynamically expressed at the midbrain-hindbrain boundary and in the embryonic neural retina. Gene Expr Patterns. 2005 Aug;5(6):786-91.
CopyrightCopyright © 2005 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 15
stage 15
stage 15
stage 16
Forebrain
Midbrain
 

Entry 8

GEISHA IdOtx2.Chapman.2008Data SourceDirect Submission
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CommentsInsufficient information provided to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # NM_204520). Images Provided by Susan Chapman.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
stage 1
stage 3
stage 3
stage 3
Area Pellucida
Epiblast
Hensen's Node
Neural Plate/Tube
Primitive Streak
 
4-6
stage 4
stage 4
stage 5
stage 6
stage 6
Epiblast
Forebrain
Hensen's Node
Midbrain
Neural Plate/Tube
Primitive Streak
 
7-12
stage 7
stage 8
stage 8
stage 9
stage 10
stage 12
Forebrain
Midbrain
Neural Plate/Tube
 
13-17
stage 17
Cranial Ganglion
Forebrain
Midbrain
Neural Plate/Tube
 

Entry 9

GEISHA IdOTX2.Agarwala.2005Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationAgarwala S, Aglyamova GV, Marma AK, Fallon JF, Ragsdale CW. Differential susceptibility of midbrain and spinal cord patterning to floor plate defects in the talpid2 mutant. Dev Biol. 2005 Dec 1;288(1):206-20. Epub 2005 Oct 21.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsAccording to the authors, "Digoxigenin (DIG)- and fluorescein-labeled riboprobes were synthesized from chick cDNA plasmids..." As information provided was insufficient to verify exact sequence used to synthesize probe,the sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-26
stage 26
Isthmus/MHB
 

Entry 10

GEISHA IdOtx-2.Albazerchi.2007Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationAlbazerchi A, Stern CD. A role for the hypoblast (AVE) in the initiation of neural induction, independent of its ability to position the primitive streak. Dev Biol. 2007 Jan 15;301(2):489-503.
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc #NM_204520.2). Although experiments are shown, normal expression can be seen in the embryo to the left.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
stage 3
Forebrain
Hensen's Node
Neural Plate/Tube
 
4-5
stage 4
stage 5
stage 5
Forebrain
Neural Plate/Tube
Primitive Streak
 

Entry 11

GEISHA IdOTX1.Plouhinec.2005Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationPlouhinec JL, Leconte L, Sauka-Spengler T, Bovolenta P, Mazan S, Saule S (2005). Comparative analysis of gnathostome Otx gene expression patterns in the developing eye: implications for the functional evolution of the multigene family. Dev Biol. 2005 Feb 15;278(2):560-75.
CopyrightCopyright © 2004 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify sequence used to synthesize probe. NCBI lists Otx1 as a conserved domain in Otx2. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 8
stage 10
stage 12
Ear/Otic Placcode
Ectoderm
Eye
Forebrain
Midbrain
Surface Ectoderm
Neural Ectoderm
13-18
stage 15
stage 16
Eye
Forebrain
Midbrain
Retina
Marginal zone of the Neural Retina
Prospective Pigmented Retina
19-24
stage 20
stage 22
stage 22
Retina
Marginal zone of the Neural Retina
Prospective Pigmented Retina
31-44
stage 35
stage 37
stage 37
stage 40
stage 40
stage 44
stage 44
stage 44
stage 44
Eye
Retina
Ciliary Process
Prospective Iris

Entry 12

GEISHA IdOTX2.Plouhinec.2005Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationPlouhinec JL, Leconte L, Sauka-Spengler T, Bovolenta P, Mazan S, Saule S (2005). Comparative analysis of gnathostome Otx gene expression patterns in the developing eye: implications for the functional evolution of the multigene family. Dev Biol. 2005 Feb 15;278(2):560-75.
CopyrightCopyright © 2004 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 16
Eye
Forebrain
Midbrain
Pharyngeal Arches and Clefts
Retina
Prospective Pigmented Retina
19-24
stage 22
stage 22
Eye
Retina
Prospective Pigmented Retina
25-30
stage 26
stage 30
Retina
 
31-44
stage 37
stage 40
stage 40
stage 44
stage 44
stage 44
stage 44
stage 44
Retina
Actual Stage: P2

Entry 13

GEISHA IdOTX2.Zhang.2001Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationZhang XM, Yang XJ (2001). Temporal and spatial effects of Sonic hedgehog signaling in chick eye morphogenesis. Dev Biol. 2001 May 15;233(2):271-90.
CopyrightCopyright © 2001 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
stage 22
stage 24
stage 24
Eye
Pigmented Epithelium

Entry 14

GEISHA IdOTX2.Foley.2000Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationFoley AC, Skromne I, Stern CD. Reconciling different models of forebrain induction and patterning: a dual role for the hypoblast. Development. 2000 Sep;127(17):3839-54.
CopyrightPrinted in Great Britain © The Company of Biologists Limited 2000
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XIII
Hypoblast
Stage XII-XIII EG&K
1-3
stage 2
Hypoblast
Primitive Streak
 
4
stage 4
stage 4
Hypoblast
Primitive Streak
 

Entry 15

GEISHA IdOTX2.Spieler.2004Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationSpieler D, Bäumer N, Stebler J, Köprunner M, Reichman-Fried M, Teichmann U, Raz E, Kessel M, Wittler L. Involvement of Pax6 and Otx2 in the forebrain-specific regulation of the vertebrate homeobox gene ANF/Hesx1. Dev Biol. 2004 May 15;269(2):567-79.
CopyrightCopyright © 2004 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204520).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Neural Plate/Tube
 
7-8
stage 8
Neural Plate/Tube
Anterior Neural Folds

Entry 16

GEISHA IdOTX2.Bok.2005Data SourcePublication
Complete cDNA Template Probeshow
CAAATGGACAAACAAATGAACATAAATCCGACGACGACAACAACGGGGACAAAAGAGGGACAGTGTTGGTGTGACCACG
TTCAGACTCATCTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAGAGGAAAACGGAGGAGGAAGGCCTTTAAAACGG
ACAGAATCATTTAGTGAGGCAGAAAACCGGACAGACCAATCCGTGTTCTTTAATAGTTTTAGGCAATTTGTTGGGGTTT
CTTTTGTTTGGAAGAGGTGGGAGATCGTTCCCACCTATGGGCCAGTTTTTAAACAAAAAAAAAAAAGTCTAGGTTTTTA
TTTCTTTTTGTGTGTGCGTGGAAAGATCCTTCACCCAGAGGTTTCCAACGTCTTAGCCAACCCTTGGTTAAAATATTCG
GAATGGACAGCGTCTCTCTTTCTCTTTTTCTCCCCTTTTTTCTCCCTCCTTCCCTCCCTCTTTCTTTCTCTCTCGCGCT
CATCCAACTGTTTGACGCCCAACTCAAGTGGGCACCGAGAGAACTTGGTTCAGGGCTGTGTGGGTTGTGTGACTGATTG
TCCTAGCTGC
CitationBok J, Bronner-Fraser M, Wu DK. Role of the hindbrain in dorsoventral but not anteroposterior axial specification of the inner ear. Development. 2005 May;132(9):2115-24. Epub 2005 Mar 23.
CopyrightCopyright for articles in Development are retained by the authors. Permission granted by MBF.
CommentsAccording to the authors, "A 562 bp of 3′-untranslated region (nucleotides 1183-1745) of chicken Otx2 (GenBank: AJ489221) was used to generate an antisense probe for Otx2." Sequence below was obtained from NCBI using this information.
no images

Entry 17

GEISHA IdOTX2.Sanchez-Calderon.2004Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationSánchez-Calderón H, Martín-Partido G, Hidalgo-Sánchez M. Otx2, Gbx2, and Fgf8 expression patterns in the chick developing inner ear and their possible roles in otic specification and early innervation. Gene Expr Patterns. 2004 Oct;4(6):659-69.
CopyrightReprinted with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placode
 
31-34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
stage 34
Ear/Otic Placode
 

Entry 18

GEISHA IdOTX2.Sanders.2002Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationSanders TA, Lumsden A, Ragsdale CW. Arcuate plan of chick midbrain development. J Neurosci. 2002 Dec 15;22(24):10742-50.
CopyrightCopyright © 2002-2011 by the Society for Neuroscience
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc# NM_204520.2)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-26
stage 26
Forebrain
Hindbrain
Midbrain
Rhombomeres
Hindbrain Expression is localized to the caudal end of Rhombomere 1.

Entry 19

GEISHA IdOTX2.Halilagic.2007Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationHalilagic A, Ribes V, Ghyselinck NB, Zile MH, Dollé P, Studer M. Retinoids control anterior and dorsal properties in the developing forebrain. Dev Bio 2007 Mar 1;303(1):244-58
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc #NM_204520.2). Images are quail, but sequence and map shown are chick.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
Eye
quail embryo
19
stage 19
Retina
quail embryo

Entry 20

GEISHA IdOTX2.Tossell.2011Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationTossell K, Kiecker C, Wizenmann A, Lang E, Irving C. Notch signalling stabilises boundary formation at the midbrain-hindbrain organiser. Development. 2011 Sep;138(17):3745-57. Epub 2011 Jul 27.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 9
stage 9
stage 9
stage 9
stage 9
stage 10
stage 10
stage 10
stage 10
stage 10
Isthmus/MHB
Mesencephalon
Midbrain
Rhombomeres
double in situ: Dl1 (blue) and Otx2 (red)
double in situ: Otx2 (red) and Gbx2 (blue)
double in situ: Lfng (blue), Otx2 (red)
double in situ: Otx2 (red), Gbx2(blue)
double in situ: Ser1 (blue), Otx2 (red)

Entry 21

GEISHA IdOTX2.Tossell.2011BData SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationTossell K, Andreae LC, Cudmore C, Lang E, Muthukrishnan U, Lumsden A, Gilthorpe JD, Irving C. Lrrn1 is required for formation of the midbrain-hindbrain boundary and organiser through regulation of affinity differences between midbrain and hindbrain cells in chick. Dev Biol. 2011 Apr 15;352(2):341-52.
CopyrightCopyright © 2011 Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204520.2).
no images

Entry 22

GEISHA IdOTX2.Lorente-Cánovas.2012Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationLorente-Cánovas B, Marín F, Corral-San-Miguel R, Hidalgo-Sánchez M, Ferrán JL, Puelles L, Aroca P. Multiple origins, migratory paths and molecular profiles of cells populating the avian interpeduncular nucleus. Dev Biol. 2012 Jan 1;361(1):12-26.
CopyrightCopyright © 2011 Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 27
stage 27
stage 29
Rhombomeres
PAX7 antibody (brown)
in situ hybridization with OTX2 (blue)
31-39
stage 36
stage 36
stage 39
Rhombomeres
PAX7 antibody (brown)
in situ hybridization with OTX2 (blue)

Entry 23

GEISHA IdOTX2.Acloque.2011Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationHervé Acloque, Oscar H. Ocaña, Ander Matheu, Karine Rizzoti, Clare Wise, Robin Lovell-Badge, M. Angela Nieto Reciprocal Repression between Sox3 and Snail Transcription Factors Defines Embryonic Territories at Gastrulation. Dev Cell. 2011 September 13; 21(3): 546–558.
CopyrightCopyright © 2011 Published by Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Neural Plate/Tube
 

Entry 24

GEISHA IdOTX2.Adams.2000Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationAdams KA, Maida JM, Golden JA, Riddle RD. The transcription factor Lmx1b maintains Wnt1 expression within the isthmic organizer. Development. 2000 May;127(9):1857-67.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors.
CommentsAs insufficient information is provided in the publication to verify the exact sequence used to synthesize the probe, the sequence below was obtained from NCBI (acc # NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
Diencephalon
Mesencephalon
 
13-15
stage 15
stage 15
stage 15
Mesencephalon
 

Entry 25

GEISHA IdOTX2.Hirashima.2008Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationHirashima M, Kobayashi T, Uchikawa M, Kondoh H, Araki M. Anteroventrally localized activity in the optic vesicle plays a crucial role in the optic development. Dev Biol. 2008 May 15;317(2):620-31. doi: 10.1016/j.ydbio.2008.03.010. Epub 2008 Mar 20.
CopyrightCopyright © 2008 Elsevier Inc. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI EF410002.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Eye
 

Entry 26

GEISHA IdOTX2.Miyazaki.2006Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationMiyazaki H, Kobayashi T, Nakamura H, Funahashi J. Role of Gbx2 and Otx2 in the formation of cochlear ganglion and endolymphatic duct. Dev Growth Differ. 2006 Sep;48(7):429-38.
CopyrightCopyright © 1999–2013 John Wiley & Sons, Inc. All Rights Reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
  
13-18
stage 14
  
19-22
stage 20
stage 22
stage 22
stage 22
stage 22
  

Entry 27

GEISHA IdOTX2.Marcucio.2005Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationMarcucio RS, Cordero DR, Hu D, Helms JA. Molecular interactions coordinating the development of the forebrain and face. Dev Biol. 2005 Aug 1;284(1):48-61.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
Hypothalamus
Telencephalon
 
all
 
  

Entry 28

GEISHA IdOtx2.Jungbluth.2001Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationStefan Jungbluth, Chris Phelps, Andrew Lumsden. CEPU-1 expression in the early embryonic chick brain. Mech Dev. 2001 Mar;101(1-2):195-7.
CopyrightCopyright © 2001 Elsevier Science Ireland Ltd.
CommentsAuthors indicated that Otx2 probe was a gift of A. Simeone. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Forebrain
Isthmus/MHB
Midbrain
double in situ: Otx2 in red, CEPU-1 in blue
13-18
stage 14
Forebrain
Isthmus/MHB
Midbrain
double in situ: Otx2 in red, CEPU-1 in blue
19
stage 19
Cranial Ganglia
Forebrain
Isthmus/MHB
Midbrain
Pharyngeal Arches and Clefts
double in situ: Otx2 in red, CEPU-1 in blue

Entry 29

GEISHA IdOtx2.Hidalgo-Sánchez.1999Data SourcePublication
Complete cDNA Template Probeshow
CCAACTCTCCTCCCCGCTCCAACTTTAGCATGATGTCTTATCTTAAGCAACCACCTTACGCAGTCAATGGCCTGAGTCT
CACCACCTCGGGCATGGATTTGTTGCATCCGTCCGTCGGTTATCCCGCCACCCCCCGAAAGCAGCGGCGGGAGCGCACC
ACCTTCACCCGGGCGCAGCTGGACGTGCTGGAGGCCCTGTTCGCCAAGACCCGCTACCCCGACATCTTCATGCGGGAGG
AGGTGGCCTTGAAAATCAACCTGCCCGAGTCCAGAGTGCAGGTGTGGTTCAAAAACCGCCGGGCCAAGTGCCGGCAGCA
GCAGCAGCAGCAGCAGAACGGGGGCCAGAACAAGGTGAGGCCGGCCAAAAAGAAGAACTCGCCGGCCCGGGAAGTGAGC
TCGGAGAGCGGGACCAGCGGGCAGTTCACACCCCCCTCCAGCACCTCGGTCCCCACCATTTCCAGCAGCAGTGCCCCCG
TGTCCATCTGGAGCCCGGCGTCCATCTCCCCGCTCTCCGATCCCCTGTCCACTTCTTCCTCCTGCATGCAGAGGTCCTA
CCCCATGACCTACACCCAGGCATCAGGTTACAGCCAAGGATATGCCGGCTCGACCTCCTATTTCGGAGGGATGGACTGT
GGATCTTATTTGACCCCTATGCACCACCAGCTCCCCGGACCGGGGGCCACCCTGAGTCCCATGGGTGCCAATGCGGTCA
CCAGCCACCTCAACCAGTCTCCAGCCTCCCTCTCCACCCAGGGCTATGGAGCCTCCAGTTTGGGCTTTAACTCGACCAC
CGATTGCTTGGATTATAAAGACCAAACCGCCTCCTGGAAGTTAAACTTCAATGCTGACTGCTTGGATTATAAAGACCAG
ACATCCTCATGGAAGTTCCAGGTTTTGTGAAGGCCCGTGGGAACCTTTGTGATAATAAGAGAAATCGTGACGAGAACAA
AACACGCTGGGCCGAACGCTCCAGCTTTAGTCAGGTCTTGGTTAAATTAAAGAGAAAATAACTAAATGGACAAATGGAC
AAACAAATGAACATAAATCCGACGACGACAACAACGGCGACAAAAGAGGGACAGTGTTGGTGTGACCACGTTCAGACTC
ATTTCCTGCTCAGACGCTCTGGAAAAGGAACGACAAAAGAGGAAAACGGAGGAGGAAGGCCTTAAACGGACAGATCATC
TAGTGAGCAGAAAACAGACAGACCAATCCGTGTTCTTTATAGTTTTAGGCAATTGTTGGGTTTCTTTGTTTGGAAAAGG
TGGGAGATCGTTCCACCTATGGGCCAGTTTTTAAAAAAAAA
CitationHidalgo-Sánchez M, Millet S, Simeone A, Alvarado-Mallart RM. Comparative analysis of Otx2, Gbx2, Pax2, Fgf8 and Wnt1 gene expressions during the formation of the chick midbrain/hindbrain domain. Mech Dev 1999 Mar;81(1-2):175-8.
CopyrightCopyright © 1999 Elsevier Science Ireland Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession NM_204520.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 10
Midbrain
Double ISH, Otx2 in purple.
Double ISH, Otx2 in red.
19-20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
Midbrain
Double ISH, Otx2 in purple.
Double ISH, Otx2 in red.
Double ISH, Otx2 in red.
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.10

Mouse

EmageMGI:97451
EurexpressMGI:97451
MGI GXDMGI:97451

Frog

Xenbase485219

Fruit Fly

BDGP

Zebra Finch

ZEBrAOTX2

Zebrafish

ZFINZDB-GENE-980526-406
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona