GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

POSTN
periostin

Gene
Official SymbolPOSTN
Official Full Nameperiostin
CGNC ID12805
also known asOSF-2, periostin|extracellular adhestion molecule|osteoblast-specific factor 2|periostin, osteoblast specific factor
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001030541
PolypeptideNP_001025712
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.5154
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly41455FBgn0260745
Human10631ENSG00000133110MIM:608777
Mouse50706ENSMUSG00000027750All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:1926321
Xenopus100127174478501
Zebrafish337176, 378983ENSDARG00000061219, ENSDARG00000043806ZDB-GENE-030131-9120, ZDB-GENE-091113-23ZFIN:ZDB-GENE-030131-9120, ZFIN:ZDB-GENE-091113-23
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395429
Ensembl GeneENSGALG00000017046
KEGGgga:395429
GEISHA IdPERIOSTIN.Norris.2004Data SourcePublication
Complete cDNA Template Probeshow
GCGACAGAGGACTAGAGATGAAGATCTTTTTATTATTCACCTTTTCCACGTTTTTCTTGTCTGCTTTTGAACAAGCAGC
CGCATCTGCTCACTATGACAAGATTTTAACTCATAGTCGAATAAGGGCACGCGACCAAGGCCCAAATGTCTGTGCCCTT
CAGCAAGTTATGGGAACCAAAAAGAAATACTTCAGCACCTGCAGAAACTGGTACCAGGGATCCATCTGTGGAAAGAAAG
CAACTGTCTTATATGAGTGCTGTCCTGGCTACATGAAGATGGATGGTATGAGAGGATGTCCTGCAGTTGTTCCTATTGA
TCATGTATATGGCACTCTTGGTATTGTGGGAGCTACCTCCACTCAGCAGTATTCTGACGTGTCAAAGCTGAGAGAAGAG
ATTGAGGGAAGAGGTTCATTCACTTTCTTTGCACCAAGTAATGAAGCCTGGGAGCAATTAAGTTCGGAAATTCACAGGA
ATTTAATTGACAATGTAAATATTGAACTATATAATGCTCTCCACCACCACATGGTAAACAAGCGCATGTTGACAAAAGA
TCTTAAGAATGGCATGACACTGGTGTCCATGTATAACGGCCAGAAATTGCTTATTAACCATTATCCTAATGGGGTTGTT
ACTGTTAACTGTGCAAGGATAATCCATGGCAACCAGATTGCTACCAATGGTGTTGTTCATGTAATTGACCGTGTCCTAA
CTGCTGTTGGAAATACCATTCAAGATTTCATTGAAGTTGAGGATGACCTTTCATCTCTCAGAGCTGCTGCCATCACGTC
AGACGTCTTAGATACTCTTGGAAGGCCTGGTTATTACACACTCTTTGCTCCTACTAATGAAGCTTTTGAGCGTCTTCCA
AGAGGAATCTTAGAAAGAATCATGGGTGACAAGGTAGCTTCTGAAGCTCTTGTGAAGTTCCATATTTTAAATACTCTTC
AGTGCTCTGAAGCGATCATGGGTGGAGCTGTCTATGAAACTTTGGAAGGAAACACACTTGAAGTTGGCTGTGATGGTGA
AACTCTTACTGTGAATGGAGTAAAGATGGTGAAACGCAAAGATATTGTGACGAGCAATGGTGTTATCCACCTCATTGAT
AGAGTGCTAATTCCTGATTCTGCCAAGCAAGTCATTGAGCTTGGAGGTGCCCAGCAGACTACTTTTACAGACCTGGTGA
CACAGCTAGGACTAGCATCTTCTCTAAGACCAGAAGGCCAATACACTCTCCTGGTACCACAGAATCGTGCTTTCTCAGA
TGACACTTTACAGATGGATCAACGGCTTCTTAAAACAATCCTGCAGAATCACATTATAAAAGTGAAAATTGGGCTCAAT
GAACTATACAATGGACAAGAGCTGGAGACAATCGGTGGAAAACTGCTAAGAGTCTTTGTGTATCGCACTGCTGTATGTG
TTGAAAATTCATGCATGGTCAGAGGAAGTAAAGAAGGAAGGAATGGTTTTATTCACGTCTTCAGACAAATCATCAAGCC
AGCAGAAAAATCTTTGCATGAAATGCTGAGAAATGATAAGCGTTTTAGTGTTTTCCTCAGTCTGGTGAAAGCTGCAGAT
TTAGATGATGTTCTGTCACGGCCTGGAGCATGGACTCTGTTTGTTCCAACTAATGATGCTTTTAAAGGTTTGACCGATG
ACGATAAGGCTGTACTGATAAGAGACAAAAATGCTCTCAGGAACATTCTTCTTTACCACCTGACACAAGGAGTTTTCAT
TGGAAGTGGCTTTGAGCCTGGTGTGACAAACATCCTTAAAACTATCCAAGGAGGAAAACTGTACTTGAAAACAGTGAAT
GATACTCTTCTAGTTAATGACCTGAAGTCAAGAGAACCTGATCTCATGGCAACCAATGGTGTAATTCATGTTATTGATA
AACTCCTATATCCAGCAGATCTGCCTGTTGGAAACGATCAGTTGCTCACAATCCTGAAGAAGCTGATCAAGTATATTCA
AATCAAGTTTGTTCGTGACAGTACCTTCAAAGAGATTCCACTGACGTTTTACAACCCATCTATTACACAGCTCACTAAA
ATAATTGAAGGAGAACCTGAGTTCAAAATAGTCAGGGAGGGGGAGACAATAACTAAAGTGATTCATGGAGAACCAATTA
TTAAAACGTACACCAAAATCATTGATGGGCGACCTGTGGAAGTGACAGAGAAAAAAGTAACAGAAGAAAGAATTATTCA
AGGTCCAGAAATAAAATATACCAGAATTACTGCAGGTGGTACGGACAATGAAGAAAATTTAAAGAGATTGCTTGAGGAA
GAGGTTACCAAGGTGACCAAATTTATTGAAGGTGATGCTCATTTACTTGAAGATGAAGAAATCAAAAGACTTCTGCAGG
GAGCTGGAACTGAGTACACCAAGGTTACTAAAGTAATTGAGGGAGAACCACAGATTATCGAGAGAGAAATCAAGAAAGT
CCGTTTGGAAGAAGCACCTGTACGGAAAGTACAAGCAAACAAGAGGACACAAGGGGGATCAGCAAGAAGGAGGACAAGA
CTAGCTTATTCTTAAAAGCTTTTCAAGATAGAATCCACAGAATTACAAGAAAACAGCGTGGTCTTTGAGAGAGAGAGAA
AATGTGGGGTTTTTTTTGTTTGTTTTTTGTTTTTTTTTAAGAAAAAAA
CitationNorris RA, Kern CB, Wessels A, Moralez EI, Markwald RR, Mjaatvedt CH. Identification and detection of the periostin gene in cardiac development. Anat Rec A Discov Mol Cell Evol Biol. 2004 Dec;281(2):1227-33.
CopyrightCopyright © 2004 Wiley-Liss, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_001030541 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 17
stage 18
Endocardium
Outflow Tract
Unlabeled
Ventricles
 
19-24
stage 21
Endocardium
Outflow Tract
Ventricles
 
25-30
stage 25
stage 25
stage 29
stage 29
stage 29
stage 29
Atria
Endocardium
Heart
Myocardium
Outflow Tract
Pharyngeal Arches and Clefts
Valves
Ventricles
 
31-38
stage 38
stage 38
stage 38
Endocardium
Heart
Myocardium
Valves
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.5154

Mouse

EmageMGI:1926321
EurexpressMGI:1926321
MGI GXDMGI:1926321

Frog

Xenbase478501

Fruit Fly

BDGPFBgn0260745

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-9120, ZDB-GENE-091113-23
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona