GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PITX2
paired like homeodomain 2

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolPITX2
Official Full Namepaired like homeodomain 2
CGNC ID49517
also known asPtx2, pituitary homeobox 2|cPITX2|homeobox protein PITX2|paired-like homeodomain transcription factor 2|transcription factor Pitx2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205010
PolypeptideNP_990341
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3398
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly43664FBgn0020912
Human5308ENSG00000164093MIM:180500MIM:601542
Mouse18741ENSMUSG00000028023All phenotypic alleles (16):Targeted, knock-out(4) Targeted, other(12) MGI:109340
Xenopus549981, 398033, 373586482491
Zebrafish30164ENSDARG00000036194ZDB-GENE-990714-27ZFIN:ZDB-GENE-990714-27
Gene Ontology
Molecular Functionsequence-specific DNA binding, sequence-specific DNA binding transcription factor activity
Biological Processdetermination of left/right symmetry, embryonic limb morphogenesis, more...positive regulation of dermatome development, positive regulation of myoblast differentiation, positive regulation of myoblast proliferation, positive regulation of myotome development, positive regulation of transcription from RNA polymerase II promoter
Cellular Componentnucleus
Links to other databases
Entrez Gene395862
Ensembl Gene
KEGGgga:395862

Entry 1

GEISHA IdO21Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GGAAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGAC
GCACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAG
GAGATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGA
GAGAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGA
CATGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCC
TTCTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCA
TGTCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCT
GAGCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGG
GACACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGA
ACCCCGCGTCCAACCTGAGCGCCTGCCAGTACGCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCGCTGCCACGGA
CTGAGCTGCGCTGGAGNAGCGGTGGGCACCCTGGAAGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAAGGAGAG
AAGGGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCT
AAGAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGA
CATTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATA
TATCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAA
ATAAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTA
TGTTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAG
ATGTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGAC
ACGAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCTTTCAGAAAAAAAAAAAAAAAAAAAAAAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
Area Opaca
 
7-12
stage 7
stage 8
stage 8
stage 8
stage 8
stage 8
stage 11
stage 11
stage 12
stage 12
stage 12
Anterior Intestinal Portal
Area Opaca
Endoderm
Endoderm, early
Extraembryonic
Face Mesenchyme
Lateral Plate Mesoderm
Mesoderm
Mesoderm, early
Splanchnic Mesoderm
Surface Ectoderm
Trunk Mesenchyme
asymmetrical
caudal asymmetry
13-18
stage 13
stage 13
stage 13
stage 13
stage 15
stage 16
stage 16
stage 16
Endoderm
Extraembryonic
Face Mesenchyme
Splanchnic Mesoderm
Surface Ectoderm
asymmetric caudally
caudal asymmetry
19-23
stage 20
stage 23
Extraembryonic
Eye
Face Mesenchyme
Lateral Plate Mesoderm
Leg Bones
Leg Mesenchyme
Limb Buds
Myocardium
Outflow Tract
Spinal Ganglia and Nerves
Splanchnic Mesoderm
Surface Ectoderm
Wing Bones
Wing Mesenchyme
Yolk Sack or Stalk
 

Entry 2

GEISHA IdChEST76c15Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCCGGCGTCCTCTCGCCGATGAGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGT
GCTCCTCCTCACCTTCCTCCTCCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCT
GGCGCCGGGGCAGGCTCGCTCCTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGC
CCCGAGGCCGCAGAGAAAGAGAAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGC
GGCAGCGGCGGCAGCGGACGCACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCC
CGACATGTCCACCCGCGAGGAGATCACCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGC
AGAGCCAAATGGAGGAAGAGAGAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCC
TGATGCAGCCCTACGATGACATGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCT
CTCCACCAAGAGCTTCCCCTTCTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCACAACCCAACCCCGCTGC
CACGGACTGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGG
AGAGAAGGGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Germinal Crescent
Hensen's Node
 
4-6
stage 4
stage 6
Area Opaca
 
7-12
stage 8
stage 10
stage 12
stage 12
Area Opaca
Extraembryonic
Head Mesenchyme
Heart Tube
Lateral Plate Mesoderm
Splanchnic Mesoderm
asymmetrical
13-18
stage 14
Extraembryonic
Pharyngeal Arches and Clefts
Surface Ectoderm
face
19-24
stage 20
stage 21
stage 23
Allantois
Amnion
Atria
Extraembryonic
Eye
Oral Pharynx
Pharyngeal Arches and Clefts
Surface Ectoderm
Yolk Sack or Stalk
 
25
stage 25
Atria
Dermatome
Eye
Leg Mesenchyme
Myotome
Pharyngeal Arches and Clefts
Somatopleure
Surface Ectoderm
Wing Mesenchyme
 

Entry 3

GEISHA IdPitx2.Noden.2006Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationNoden DM, Francis-West P. The differentiation and morphogenesis of craniofacial muscles. Dev Dyn. 2006 May;235(5):1194-218. Review.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205010).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
Eye
Neural Crest
Extraoccular Muscles

Entry 4

GEISHA IdPitx2.Bothe.2006Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCA
CitationBothe I, Dietrich S. The molecular setup of the avian head mesoderm and its implication for craniofacial myogenesis. Dev Dyn. 2006 Oct;235(10):2845-60.
CopyrightCopyright © 2006 Wiley-Liss, Inc.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
Endoderm
Head Mesenchyme
Mesoderm
 

Entry 5

GEISHA IdPITX2.Bothe.2007Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationBothe I, Ahmed MU, Winterbottom FL, von Scheven G, Dietrich S. Extrinsic versus intrinsic cues in avian paraxial mesoderm patterning and differentiation. Dev Dyn. 2007 Sep;236(9):2397-409.
CopyrightCopyright © 2007 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205010).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
Head Mesenchyme
 

Entry 6

GEISHA IdPitx2.Garcia-Castro.2000Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationGarcía-Castro MI, Vielmetter E, Bronner-Fraser M. N-Cadherin, a cell adhesion molecule involved in establishment of embryonic left-right asymmetry. Science. 2000 May 12;288(5468):1047-51.
CopyrightCopyright © 2000, The American Association for the Advancement of Science
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc NM_205010.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
stage 3
Lateral Plate Mesoderm
Mesoderm
 

Entry 7

GEISHA IdPitx2.Lopez-Sanchez.2009Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationLopez-Sanchez C, Garcia-Masa N, Gañan CM, Garcia-Martinez V. Movement and commitment of primitive streak precardiac cells during cardiogenesis. Int J Dev Biol. 2009;53(8-10):1445-55.
CopyrightReprinted from Int. J. Dev. Biol. Copyright (2009), with permission from UBC Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Complete cDNA template sequence obtained from ncbi (accession #NM_205010 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-8
stage 7
stage 7
stage 7
stage 7
stage 8
stage 8
Anterior/Second Heart Field
Lateral Plate Mesoderm
Splanchnic Mesoderm
(C,D) shows the cells from site C2 forming the
(C1.5) at the same time contributed to forming bilateral mesoder-
In stages PS11-14 (Fig. 2), most cells located
asymmetrical
at the rostral site (C0.5) contributed in the anterior half of the
embryo to forming the more anterior and lateral endodermal area,
in a crescent-shaped pattern; while cells from a more caudal site
mal areas, reaching the border with the area pellucida, and
ment (red), and cells from site C1 forming
overlapping with the caudal limits of the aforementioned crescent.
splanchnic mesoderm of the heart rudi-
the underlying endoderm (blue).

Entry 8

GEISHA IdPITX2.Parkinson.2010Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationParkinson N, Collins MM, Dufresne L, Ryan AK. Expression patterns of hormones, signaling molecules, and transcription factors during adenohypophysis development in the chick embryo. Dev Dyn. 2010 Apr;239(4):1197-210.
CopyrightCopyright © 2010 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # AF076640.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 21
Pituitary (Rudiment)
 
25-30
stage 28
Pituitary (Rudiment)
 
31-36
stage 32
stage 36
Pituitary (Rudiment)
 

Entry 9

GEISHA IdPITX2.Bothe.2011Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationBothe I, Tenin G, Oseni A, Dietrich S., Dynamic control of head mesoderm patterning., Development. 2011 Jul;138(13):2807-21.
CopyrightPermission from the authors and the Company of Biologists Ltd. Copyright held by the authors.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205010.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Head Mesenchyme
 
7-10
stage 10
stage 10
stage 10
stage 10
stage 10
stage 10
Head Mesenchyme
Lateral Plate Mesoderm
 

Entry 10

GEISHA IdPITX2.Schlueter.2009Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationJan Schlueter, Thomas Brand. A right-sided pathway involving FGF8/Snai1 controls asymmetric development of the proepicardium in the chick embryo. Proc Natl Acad Sci U S A. 2009 May 5; 106(18): 7485–7490.
CopyrightCopyright 2009 National Academy of Sciences
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205010.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Atria
Sinus Venosus
 
13-15
stage 15
stage 15
Atria
Sinus Venosus
 

Entry 11

GEISHA IdPITX2.WangS.2004Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationWang S, Yu X, Zhang T, Zhang X, Zhang Z, Chen Y. Chick Pcl2 regulates the left-right asymmetry by repressing Shh expression in Hensen's node. Development. 2004 Sep;131(17):4381-91. Epub 2004 Aug 4.
Copyrightcopyright 2004 to the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205010.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
Lateral Plate Mesoderm
 
7-11
stage 11
stage 11
Lateral Plate Mesoderm
 

Entry 12

GEISHA IdPITX2.Schneider.1999Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (Acc. # NM_205010.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
Splanchnic Mesoderm
double-color in situ: Pitx2(red staining) and NKX3.2(blue staining)

Entry 13

GEISHA IdPitx2c.Yu.2001Data SourcePublication
Complete cDNA Template Probeshow
GTCCTCTCGCCGATGAGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCT
CCTCACCTTCCTCCTCCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCC
GGGGCAGGCTCGCTCCTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAG
GCCGCAGAGAAAGAGAAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGC
GGCGGCAGCGGACGCACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACAT
GTCCACCCGCGAGGAGATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCC
AAATGGAGGAAGAGAGAG
CitationYu X, St Amand TR, Wang S, Li G, Zhang Y, Hu YP, Nguyen L, Qiu MS, Chen YP. Differential expression and functional analysis of Pitx2 isoforms in regulation of heart looping in the chick. Development. 2001 Mar;128(6):1005-13
Copyright© 2001 by Company of Biologists
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Yu et al. 2001.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Hypoblast
 
7-12
stage 8
stage 8
stage 11
stage 11
Head Mesenchyme
Heart Tube
Lateral Plate Mesoderm
 
13-18
stage 13
stage 15
Unlabeled
 
31-44
stage 44
  

Entry 14

GEISHA IdPitx2.Yu.2001Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationYu X, St Amand TR, Wang S, Li G, Zhang Y, Hu YP, Nguyen L, Qiu MS, Chen YP. Differential expression and functional analysis of Pitx2 isoforms in regulation of heart looping in the chick. Development. 2001 Mar;128(6):1005-13
Copyright© 2001 by Company of Biologists
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Yu et al. 2001.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 15
Blood Islands
Endothelial Cells
 
31-44
stage 44
  

Entry 15

GEISHA IdPITX2.Lee.2020Data SourcePublication
Complete cDNA Template Probeshow
GCACGAGCGGGCACACGCGCTCCTTCTCCCGTCAGCCCCTCCGGGCGCGCCCGTCGGCTCCGGCGTCCTCTCGCCGATG
AGTTGCATGAAGGACCCGTTAAGCCTGGAGCGCCTGGGAGCCGGGAATAATAAGCTGTGCTCCTCCTCACCTTCCTCCT
CCTCCTCCTCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTC
CTCCCTGGAGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAG
AAGAGCCAGCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGC
ACTTCACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGA
GATCGCCGTCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGA
GAGAGGAACCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACA
TGTACCCCGGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTT
CTTCAACTCCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATG
TCCTCCAGCATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGA
GCAACCCCTCCCTCAACTCGGCAGTGCCCACGCCGGCCTGTCCGTACGCCCCTCCGACGCCTCCATACGTTTATAGGGA
CACGTGTAACTCGAGCTTGGCCAGCCTGAGACTCAAAGCCAAGCAGCACTCCAGCTTTGGCTACGCCAGCGTGCAGAAC
CCCGCGTCCAACCTGAGCGCCTGCCAGTACCCCGTGGACAGGCCCGTGTGAGCACAACCCAACCCCCGTTGCCACGGAC
TGAGCTGCGCTGGAGAGCGGTGGGCACCGTGGAGGAGGAGAGGGGGGAAGACGGAGAGAGAGGGGAAAGAGGAGAGAAG
GGAGTAAAGGAAACCACTGAAACGAGATAGTTCCTTTGTTTTCAAAGGACCTCCTACAGATCGGGAGATCTTCGCTAAG
GAGTATTTCAGCAGTTACGAGGACATATATATATATATATATATATACGGACAAATGGTTGACTGGATATGATATGACA
TTTTAATGTTCCTATAAGCTTGTTATTTTTTAAGTTTAGCGTTGTTAACATAAAAAATGACGGAAAGGATGTATATATA
TCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAAGGGTAGGCTTTAAAAT
AAAGCATGTTACACAGAAGCGATTAGGAGTTTTTCGCTTGCGAGCAAGGGAATGTATATACTAAATGCGACACTGTATG
TTTCTAACATATAATTATTAAAAACAAAACATTGTGTGAATATCGGTTTTAGAATAGTACCTCTGGTGGATGCAAAGAT
GTTTCTGATATTGCAATGTAAAACATGCCCTGTGTATAACATTTCGTACAATATTCTCGTTTTACTTTTCAGCCGACAC
GAAAAATAATGTGTTTTATTTCATGGGAGTAAAAGATGCAGCATTCAAAAAAAAAAAGAAAAAA
CitationHyung Chul Lee, Hui-Chun Lu, Mark Turmaine, Nidia M. M. Oliveira, Youwen Yang† , Irene De Almeida and Claudio D. Stern. Molecular anatomy of the pre-primitive streak chick embryo Open Biol. null. 10.1098/rsob.190299.
CopyrightCopyright © 2020 The Authors.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205010.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
stage XII
stage XII
stage XIV
stage XIV
Area Opaca
Area Pellucida
Epiblast
Hypoblast
Kohler's Sickle
Stage EGK X-XI
Stage EGK XII-XIII
Stage EGK XIII-XIV
all
 
  

Entry 16

GEISHA IdPITX2.Sjödal.2008Data SourcePublication
Complete cDNA Template Probeshow
TCGTCCTCCTGCCATCACCAGCAGCCCGCGCTGGCCATGGCGACGGCGCTGGCGCCGGGGCAGGCTCGCTCCTCCCTGG
AGGCCGCCAAGCACCGGCTGGAGGTGCACACTATCTCTGACACCTCCAGCCCCGAGGCCGCAGAGAAAGAGAAGAGCCA
GCAGGGCAAGAGCGAGGATGCGGGGCCCGAGGACCCCTCCAAGAAGAAGCGGCAGCGGCGGCAGCGGACGCACTTCACC
AGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGCGGAACCGCTACCCCGACATGTCCACCCGCGAGGAGATCGCCG
TCTGGACCAACCTCACCGAGGCCCGGGTTCGGGTTTGGTTCAAGAACCGCAGAGCCAAATGGAGGAAGAGAGAGAGGAA
CCAGCAGGCCGAGCTGTGCAAGAACGGCTTCGGGCCGCAGTTCAATGGCCTGATGCAGCCCTACGATGACATGTACCCC
GGGTACTCGTACAACAACTGGGCAGCCAAGGGCCTCACCTCCGCCTCCCTCTCCACCAAGAGCTTCCCCTTCTTCAACT
CCATGAATGTCAACCCGCTGTCCTCCCAGAGCATGTTCTCCCCTCCCAACTCCATCTCCTCCATGAGCATGTCCTCCAG
CATGGTGCCCTCGGCGGTCACCGGCGTGCCCGGCTCCGGCCTCAACAGCCTGAACAACTTGAACAACCTGAGCAACCCC
TCCCTCAACT
CitationSjödal M, Gunhaga L. Expression patterns of Shh, Ptc2, Raldh3, Pitx2, Isl1, Lim3 and Pax6 in the developing chick hypophyseal placode and Rathke’s pouch. Gene Expr Patterns. 2008 Sep;8(7-8):481-5. Epub 2008 Jul 4.. DOI: 10.1016/j.gep.2008.06.007.
CopyrightCopyright © 2008 Elsevier B.V.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Sjödal et al. 2008.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
Ectoderm
Head Mesenchyme
hyp = prospective hypophyseal placode
13-18
stage 13
stage 17
Ectoderm
Head Mesenchyme
Rathke's pouch
Rathke's pouch
19-24
stage 20
stage 24
Ectoderm
Head Mesenchyme
Rathke's pouch
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3398

Mouse

EmageMGI:109340
EurexpressMGI:109340
MGI GXDMGI:109340

Frog

Xenbase482491

Fruit Fly

BDGPFBgn0020912

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990714-27
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona